Mutagenetix > Incidental Mutations

Incidental Mutation 'R8135:Gaa'

632226

Institutional Source

Beutler Lab

Gene Symbol

Gaa

Ensembl Gene

ENSMUSG00000025579

Gene Name

glucosidase, alpha, acid

Synonyms

E430018M07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.579) question?

Stock #

R8135 (G1)

Quality Score

210.009

Status

Not validated

Chromosome

Chromosomal Location

119267887-119285454 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 119278384 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000026666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106258] [ENSMUST00000106259] [ENSMUST00000132706]

Predicted Effect

probably null
Transcript: ENSMUST00000026666

SMART Domains

Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:Gal_mutarotas_2	254	320	3.7e-12	PFAM
Pfam:Glyco_hydro_31	340	825	8.8e-175	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106258

SMART Domains

Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000106259

SMART Domains

Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PD	80	134	1.08e-15	SMART
Pfam:NtCtMGAM_N	147	253	3.5e-32	PFAM
Pfam:Gal_mutarotas_2	254	320	6.5e-12	PFAM
Pfam:Glyco_hydro_31	340	825	1.8e-153	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132706

SMART Domains

Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	46	269	2.9e-72	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143288

SMART Domains

Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	8	207	2.2e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150562

SMART Domains

Protein: ENSMUSP00000115128
Gene: ENSMUSG00000025579

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	1	96	4.3e-28	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,696,995	I420V	probably benign	Het
Adam7	A	T	14: 68,516,573	M359K	probably damaging	Het
Adra1d	C	T	2: 131,561,772	A133T	probably damaging	Het
B3galnt2	T	A	13: 13,970,869		probably null	Het
Camk1g	A	G	1: 193,354,027	V175A	possibly damaging	Het
Cfi	A	G	3: 129,855,000	N178D	probably benign	Het
Csf2rb	T	A	15: 78,348,119	I542K	possibly damaging	Het
Ctsz	T	C	2: 174,429,153	T183A	probably benign	Het
Dhx8	A	G	11: 101,738,264	D213G	unknown	Het
Dph7	T	C	2: 24,969,544	I271T	probably benign	Het
Edem1	G	T	6: 108,829,061	E108*	probably null	Het
Enpp4	T	C	17: 44,101,335	T328A	probably benign	Het
Fasl	A	G	1: 161,787,128	V122A	probably benign	Het
Fut2	T	C	7: 45,651,142	T69A	probably damaging	Het
Galnt5	T	A	2: 58,014,868	V481D	probably damaging	Het
Gsdma2	A	G	11: 98,652,046	I211V	probably benign	Het
H2-M10.4	T	C	17: 36,461,770	T107A	probably benign	Het
Iqcg	T	A	16: 33,029,024	K297N	probably benign	Het
Map2	A	G	1: 66,413,669	T573A	probably damaging	Het
Nhsl1	A	G	10: 18,531,432	D1438G	probably damaging	Het
Nipal2	A	T	15: 34,678,573	Y41N	possibly damaging	Het
Obscn	A	T	11: 59,031,877	S5878T	possibly damaging	Het
Pde6a	T	C	18: 61,285,925	F791L	probably damaging	Het
Phip	A	T	9: 82,930,374	N308K	probably benign	Het
Pigc	A	G	1: 161,970,565	K39E	possibly damaging	Het
Robo2	T	G	16: 73,933,160	I1050L	probably benign	Het
Rps2	A	G	17: 24,720,435	K54E	probably benign	Het
Set	T	A	2: 30,069,427	D137E	probably benign	Het
Sipa1l1	A	G	12: 82,341,301	I100M	probably benign	Het
Spdye4b	T	C	5: 143,195,022	V81A	probably damaging	Het
Tbc1d2	T	C	4: 46,609,071	D722G	probably benign	Het
Tecpr1	T	A	5: 144,198,602	D1011V	probably damaging	Het
Unc80	A	T	1: 66,509,287	I573F	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,603	C277S	probably benign	Het
Vwa1	T	A	4: 155,772,894	D149V	probably damaging	Het
Zfp397	T	A	18: 23,956,507	V23E	probably damaging	Het
Zmynd8	T	C	2: 165,812,426	D722G	probably damaging	Het

Other mutations in Gaa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Gaa	APN	11	119274960	missense	probably benign
IGL00780:Gaa	APN	11	119274291	splice site	probably null
IGL00975:Gaa	APN	11	119274683	missense	possibly damaging	0.93
IGL01354:Gaa	APN	11	119270568	missense	probably benign	0.18
IGL01572:Gaa	APN	11	119284177	missense	probably benign
IGL01634:Gaa	APN	11	119274076	missense	possibly damaging	0.79
IGL01724:Gaa	APN	11	119275121	missense	possibly damaging	0.65
IGL01889:Gaa	APN	11	119278297	missense	probably benign	0.03
IGL02052:Gaa	APN	11	119284195	missense	possibly damaging	0.76
IGL02173:Gaa	APN	11	119274913	missense	probably damaging	1.00
IGL02261:Gaa	APN	11	119281265	makesense	probably null
IGL02337:Gaa	APN	11	119277603	missense	probably damaging	1.00
IGL02625:Gaa	APN	11	119274733	missense	probably damaging	1.00
IGL02818:Gaa	APN	11	119276848	missense	probably damaging	0.97
R0135:Gaa	UTSW	11	119278890	missense	probably benign	0.00
R0280:Gaa	UTSW	11	119284547	missense	probably damaging	1.00
R0479:Gaa	UTSW	11	119281236	missense	possibly damaging	0.95
R1130:Gaa	UTSW	11	119274683	missense	probably damaging	0.97
R1132:Gaa	UTSW	11	119285059	missense	probably damaging	0.99
R1146:Gaa	UTSW	11	119274904	missense	probably damaging	1.00
R1146:Gaa	UTSW	11	119274904	missense	probably damaging	1.00
R1179:Gaa	UTSW	11	119281128	missense	probably damaging	0.98
R1464:Gaa	UTSW	11	119272984	missense	probably benign	0.02
R1464:Gaa	UTSW	11	119272984	missense	probably benign	0.02
R1475:Gaa	UTSW	11	119274316	splice site	probably null
R1711:Gaa	UTSW	11	119280460	missense	probably damaging	1.00
R1817:Gaa	UTSW	11	119284498	nonsense	probably null
R1828:Gaa	UTSW	11	119283272	missense	probably damaging	0.99
R2013:Gaa	UTSW	11	119284583	splice site	probably null
R2126:Gaa	UTSW	11	119270282	nonsense	probably null
R2179:Gaa	UTSW	11	119275058	critical splice acceptor site	probably null
R2496:Gaa	UTSW	11	119283705	missense	possibly damaging	0.53
R2936:Gaa	UTSW	11	119283724	missense	probably benign	0.02
R4321:Gaa	UTSW	11	119270137	missense	probably benign	0.20
R4603:Gaa	UTSW	11	119278958	missense	probably damaging	1.00
R4849:Gaa	UTSW	11	119272987	missense	possibly damaging	0.95
R5225:Gaa	UTSW	11	119276843	missense	probably damaging	1.00
R5643:Gaa	UTSW	11	119280535	missense	possibly damaging	0.96
R5644:Gaa	UTSW	11	119280535	missense	possibly damaging	0.96
R6074:Gaa	UTSW	11	119284186	missense	probably benign	0.07
R6154:Gaa	UTSW	11	119278352	missense	probably damaging	1.00
R6208:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6209:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6258:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6259:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R6260:Gaa	UTSW	11	119281171	missense	probably benign	0.01
R7173:Gaa	UTSW	11	119278991	missense	probably damaging	1.00
R7211:Gaa	UTSW	11	119284204	missense	possibly damaging	0.80
R7379:Gaa	UTSW	11	119283699	missense	probably benign
R8011:Gaa	UTSW	11	119272936	missense	probably benign	0.00
R8192:Gaa	UTSW	11	119270409	missense	possibly damaging	0.92
X0064:Gaa	UTSW	11	119274015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGGAGGTGTCAATCAAAGC -3'
(R):5'- CTTAACATCTGGGCTGGTCTG -3'

Sequencing Primer
(F):5'- TGTCAATCAAAGCAGAGGGTGTG -3'
(R):5'- CCTTTCATGACCCTGACAT -3'

Posted On

2020-06-30