Incidental Mutation 'R8135:B3galnt2'
ID632228
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 13970869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099747] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000222110] [ENSMUST00000223483]
Predicted Effect probably null
Transcript: ENSMUST00000099747
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221300
Predicted Effect probably null
Transcript: ENSMUST00000221333
Predicted Effect probably null
Transcript: ENSMUST00000221974
Predicted Effect probably benign
Transcript: ENSMUST00000222110
Predicted Effect probably benign
Transcript: ENSMUST00000223483
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3686:B3galnt2 UTSW 13 13975635 critical splice donor site probably null
R3954:B3galnt2 UTSW 13 13966454 missense probably benign 0.04
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5564:B3galnt2 UTSW 13 13995229 missense probably damaging 1.00
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R6656:B3galnt2 UTSW 13 13975576 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7582:B3galnt2 UTSW 13 13991401 missense probably damaging 1.00
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAATCAGCCTTCATAAATGCTAGGG -3'
(R):5'- AGATGCACTGTCTTCCTGAAG -3'

Sequencing Primer
(F):5'- CTTCATAAATGCTAGGGCCTCAAAGG -3'
(R):5'- CAACCCTGAAAATCTGTGTCAG -3'
Posted On2020-06-30