Mutagenetix > Incidental Mutations

Incidental Mutation 'R8135:Csf2rb'

632231

Institutional Source

Beutler Lab

Gene Symbol

Csf2rb

Ensembl Gene

ENSMUSG00000071713

Gene Name

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

Synonyms

Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131

MMRRC Submission

Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8135 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78325752-78353847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78348119 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 542 (I542K)

Ref Sequence

ENSEMBL: ENSMUSP00000094082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096355
AA Change: I542K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: I542K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SCOP:d1gh7a1	29	130	6e-58	SMART
FN3	136	224	4.44e0	SMART
Blast:FN3	245	338	3e-24	BLAST
SCOP:d1gh7a3	245	338	2e-45	SMART
FN3	343	426	2.41e0	SMART
transmembrane domain	446	468	N/A	INTRINSIC
low complexity region	716	743	N/A	INTRINSIC
low complexity region	824	845	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229678

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230264
AA Change: I542K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,696,995	I420V	probably benign	Het
Adam7	A	T	14: 68,516,573	M359K	probably damaging	Het
Adra1d	C	T	2: 131,561,772	A133T	probably damaging	Het
B3galnt2	T	A	13: 13,970,869		probably null	Het
Camk1g	A	G	1: 193,354,027	V175A	possibly damaging	Het
Cfi	A	G	3: 129,855,000	N178D	probably benign	Het
Ctsz	T	C	2: 174,429,153	T183A	probably benign	Het
Dhx8	A	G	11: 101,738,264	D213G	unknown	Het
Dph7	T	C	2: 24,969,544	I271T	probably benign	Het
Edem1	G	T	6: 108,829,061	E108*	probably null	Het
Enpp4	T	C	17: 44,101,335	T328A	probably benign	Het
Fasl	A	G	1: 161,787,128	V122A	probably benign	Het
Fut2	T	C	7: 45,651,142	T69A	probably damaging	Het
Gaa	T	C	11: 119,278,384		probably null	Het
Galnt5	T	A	2: 58,014,868	V481D	probably damaging	Het
Gsdma2	A	G	11: 98,652,046	I211V	probably benign	Het
H2-M10.4	T	C	17: 36,461,770	T107A	probably benign	Het
Iqcg	T	A	16: 33,029,024	K297N	probably benign	Het
Map2	A	G	1: 66,413,669	T573A	probably damaging	Het
Nhsl1	A	G	10: 18,531,432	D1438G	probably damaging	Het
Nipal2	A	T	15: 34,678,573	Y41N	possibly damaging	Het
Obscn	A	T	11: 59,031,877	S5878T	possibly damaging	Het
Pde6a	T	C	18: 61,285,925	F791L	probably damaging	Het
Phip	A	T	9: 82,930,374	N308K	probably benign	Het
Pigc	A	G	1: 161,970,565	K39E	possibly damaging	Het
Robo2	T	G	16: 73,933,160	I1050L	probably benign	Het
Rps2	A	G	17: 24,720,435	K54E	probably benign	Het
Set	T	A	2: 30,069,427	D137E	probably benign	Het
Sipa1l1	A	G	12: 82,341,301	I100M	probably benign	Het
Spdye4b	T	C	5: 143,195,022	V81A	probably damaging	Het
Tbc1d2	T	C	4: 46,609,071	D722G	probably benign	Het
Tecpr1	T	A	5: 144,198,602	D1011V	probably damaging	Het
Unc80	A	T	1: 66,509,287	I573F	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,603	C277S	probably benign	Het
Vwa1	T	A	4: 155,772,894	D149V	probably damaging	Het
Zfp397	T	A	18: 23,956,507	V23E	probably damaging	Het
Zmynd8	T	C	2: 165,812,426	D722G	probably damaging	Het

Other mutations in Csf2rb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Csf2rb	APN	15	78348514	nonsense	probably null
IGL00979:Csf2rb	APN	15	78348104	missense	probably damaging	1.00
IGL01613:Csf2rb	APN	15	78335302	intron	probably benign
IGL01724:Csf2rb	APN	15	78336414	missense	probably damaging	1.00
IGL01942:Csf2rb	APN	15	78340492	missense	probably benign
IGL02479:Csf2rb	APN	15	78341724	nonsense	probably null
3-1:Csf2rb	UTSW	15	78344603	missense	probably damaging	1.00
IGL02802:Csf2rb	UTSW	15	78338903	missense	probably benign	0.00
R0133:Csf2rb	UTSW	15	78339004	unclassified	probably benign
R0179:Csf2rb	UTSW	15	78336372	missense	possibly damaging	0.52
R0487:Csf2rb	UTSW	15	78348331	missense	probably benign	0.00
R1544:Csf2rb	UTSW	15	78340755	missense	probably benign	0.02
R1619:Csf2rb	UTSW	15	78335211	missense	probably damaging	0.99
R1690:Csf2rb	UTSW	15	78348644	missense	probably benign	0.11
R1831:Csf2rb	UTSW	15	78348253	missense	probably benign	0.03
R3970:Csf2rb	UTSW	15	78341467	missense	probably benign
R4922:Csf2rb	UTSW	15	78346467	missense	probably benign	0.02
R5151:Csf2rb	UTSW	15	78340581	missense	probably damaging	1.00
R5202:Csf2rb	UTSW	15	78349057	missense	possibly damaging	0.51
R5398:Csf2rb	UTSW	15	78348620	missense	probably benign
R5496:Csf2rb	UTSW	15	78340561	missense	probably damaging	1.00
R5786:Csf2rb	UTSW	15	78348955	missense	probably damaging	1.00
R6166:Csf2rb	UTSW	15	78344566	missense	probably damaging	1.00
R6347:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6350:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6899:Csf2rb	UTSW	15	78340702	missense	probably benign	0.01
R6984:Csf2rb	UTSW	15	78345519	missense	probably damaging	1.00
R7484:Csf2rb	UTSW	15	78338899	missense	possibly damaging	0.53
R7671:Csf2rb	UTSW	15	78338930	missense	probably damaging	1.00
R7751:Csf2rb	UTSW	15	78341639	missense	probably damaging	1.00
R7781:Csf2rb	UTSW	15	78344571	missense	probably benign	0.00
R7861:Csf2rb	UTSW	15	78349157	missense	probably damaging	1.00
R8154:Csf2rb	UTSW	15	78340442	critical splice acceptor site	probably null
R8299:Csf2rb	UTSW	15	78346469	missense	possibly damaging	0.88
R8315:Csf2rb	UTSW	15	78347381	missense	possibly damaging	0.83
X0024:Csf2rb	UTSW	15	78336360	missense	probably damaging	1.00
X0028:Csf2rb	UTSW	15	78349002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCACAGGACCTCATGCCTC -3'
(R):5'- CATGTACTCCAAGGAGCCTG -3'

Sequencing Primer
(F):5'- ATGCCTCGGTGCTTACTG -3'
(R):5'- AGTGCTGGCTTCAGGCTC -3'

Posted On

2020-06-30