Incidental Mutation 'R8135:Robo2'
ID632233
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73933160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1050 (I1050L)
Ref Sequence ENSEMBL: ENSMUSP00000112776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000138852] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect probably benign
Transcript: ENSMUST00000116586
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117200
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117785
AA Change: I1050L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: I1050L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138852
Predicted Effect probably benign
Transcript: ENSMUST00000226478
AA Change: I1054L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227347
Predicted Effect probably benign
Transcript: ENSMUST00000231889
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
R7192:Robo2 UTSW 16 73920750 missense probably benign 0.19
R7569:Robo2 UTSW 16 74035115 missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73958405 missense probably damaging 1.00
R7720:Robo2 UTSW 16 73897015 missense probably benign 0.00
R7772:Robo2 UTSW 16 73961889 missense probably benign 0.24
R7822:Robo2 UTSW 16 73973171 missense probably damaging 1.00
R7849:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7897:Robo2 UTSW 16 73898950 missense probably benign
R8297:Robo2 UTSW 16 74015926 nonsense probably null
R8307:Robo2 UTSW 16 73956610 missense probably damaging 1.00
R8379:Robo2 UTSW 16 73933700 missense probably damaging 0.99
R8393:Robo2 UTSW 16 73978494 missense probably damaging 1.00
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73933591 missense probably benign 0.35
Z1177:Robo2 UTSW 16 73940299 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATGCTAGCTAGGAACACAGGTC -3'
(R):5'- CCAACACCGATGGTTTCATTC -3'

Sequencing Primer
(F):5'- GGAACACAGGTCATATGCTCTTGAC -3'
(R):5'- CAACACCGATGGTTTCATTCTTTTAG -3'
Posted On2020-06-30