Incidental Mutation 'R8135:Rps2'
ID632234
Institutional Source Beutler Lab
Gene Symbol Rps2
Ensembl Gene ENSMUSG00000044533
Gene Nameribosomal protein S2
SynonymsLlrep3, Rps2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R8135 (G1)
Quality Score87.0076
Status Not validated
Chromosome17
Chromosomal Location24718116-24721929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24720435 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 54 (K54E)
Ref Sequence ENSEMBL: ENSMUSP00000131474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054289
AA Change: K54E

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533
AA Change: K54E

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146867
AA Change: K54E

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533
AA Change: K54E

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152407
AA Change: K54E

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533
AA Change: K54E

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170715
AA Change: K54E

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533
AA Change: K54E

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Rps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Rps2 APN 17 24720676 missense probably damaging 1.00
IGL02981:Rps2 APN 17 24721724 missense probably benign 0.00
IGL03123:Rps2 APN 17 24720289 unclassified probably benign
R2504:Rps2 UTSW 17 24720379 unclassified probably benign
R3160:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3161:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3162:Rps2 UTSW 17 24720978 missense probably benign 0.16
R5877:Rps2 UTSW 17 24720916 intron probably benign
R7247:Rps2 UTSW 17 24720580 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGACACAGTTTTGGCAGGAC -3'
(R):5'- AACAGGTAGATCTCCTCCAAGG -3'

Sequencing Primer
(F):5'- TTTTGGCAGGACCGCACAG -3'
(R):5'- AGGTAGATCTCCTCCAAGGACTTG -3'
Posted On2020-06-30