Incidental Mutation 'R8135:H2-M10.4'
ID632235
Institutional Source Beutler Lab
Gene Symbol H2-M10.4
Ensembl Gene ENSMUSG00000048231
Gene Namehistocompatibility 2, M region locus 10.4
Synonyms15H
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36458917-36462334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36461770 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 107 (T107A)
Ref Sequence ENSEMBL: ENSMUSP00000058686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057502] [ENSMUST00000169950]
Predicted Effect probably benign
Transcript: ENSMUST00000057502
AA Change: T107A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058686
Gene: ENSMUSG00000048231
AA Change: T107A

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 5.7e-45 PFAM
IGc1 222 293 7.45e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169950
AA Change: T107A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130832
Gene: ENSMUSG00000048231
AA Change: T107A

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 8.2e-45 PFAM
IGc1 222 293 7.45e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in H2-M10.4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:H2-M10.4 APN 17 36460467 missense probably damaging 1.00
IGL02651:H2-M10.4 APN 17 36460656 missense probably benign 0.10
IGL02821:H2-M10.4 APN 17 36460431 missense probably damaging 1.00
IGL03123:H2-M10.4 APN 17 36461920 missense probably damaging 0.99
IGL03171:H2-M10.4 APN 17 36461250 missense probably damaging 0.98
R0206:H2-M10.4 UTSW 17 36460483 missense probably damaging 1.00
R0208:H2-M10.4 UTSW 17 36460483 missense probably damaging 1.00
R3979:H2-M10.4 UTSW 17 36461985 missense probably benign 0.23
R4535:H2-M10.4 UTSW 17 36461844 missense probably damaging 0.97
R4685:H2-M10.4 UTSW 17 36461796 missense probably benign 0.23
R4702:H2-M10.4 UTSW 17 36461982 missense probably benign 0.25
R5390:H2-M10.4 UTSW 17 36460641 missense probably damaging 1.00
R5945:H2-M10.4 UTSW 17 36460626 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACAGCCTGTAGTTCTCTGGGG -3'
(R):5'- TCACACTGGCTGAAGACTTTC -3'

Sequencing Primer
(F):5'- CTGGGGTCTAAAATACAGGGTTCCC -3'
(R):5'- GTTCATCCAGGTCAGCTATGTAGAC -3'
Posted On2020-06-30