Incidental Mutation 'R8135:Enpp4'
ID632236
Institutional Source Beutler Lab
Gene Symbol Enpp4
Ensembl Gene ENSMUSG00000023961
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 4
Synonyms4933413N07Rik, LOC224794
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44096308-44105809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44101335 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 328 (T328A)
Ref Sequence ENSEMBL: ENSMUSP00000024757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024757] [ENSMUST00000143137]
Predicted Effect probably benign
Transcript: ENSMUST00000024757
AA Change: T328A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024757
Gene: ENSMUSG00000023961
AA Change: T328A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 31 342 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143137
AA Change: T328A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114429
Gene: ENSMUSG00000023961
AA Change: T328A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 31 342 5.7e-80 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Enpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Enpp4 APN 17 44099603 missense possibly damaging 0.56
IGL02150:Enpp4 APN 17 44102158 missense probably benign 0.22
IGL02451:Enpp4 APN 17 44101424 missense probably damaging 1.00
IGL02879:Enpp4 APN 17 44101950 missense probably benign 0.00
R0005:Enpp4 UTSW 17 44102175 missense probably benign 0.04
R0540:Enpp4 UTSW 17 44099495 missense probably damaging 1.00
R0607:Enpp4 UTSW 17 44099495 missense probably damaging 1.00
R0942:Enpp4 UTSW 17 44101881 nonsense probably null
R1334:Enpp4 UTSW 17 44102368 missense probably benign 0.02
R1632:Enpp4 UTSW 17 44099653 missense probably damaging 0.99
R2567:Enpp4 UTSW 17 44101845 missense probably damaging 0.97
R4272:Enpp4 UTSW 17 44101807 missense probably benign 0.01
R4273:Enpp4 UTSW 17 44101807 missense probably benign 0.01
R4750:Enpp4 UTSW 17 44102355 missense probably damaging 1.00
R6267:Enpp4 UTSW 17 44102480 missense probably benign 0.00
R6296:Enpp4 UTSW 17 44102480 missense probably benign 0.00
R7180:Enpp4 UTSW 17 44102037 missense probably benign 0.03
R8036:Enpp4 UTSW 17 44102245 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AACCTCCAGACGGAAGAGTG -3'
(R):5'- TATATCTTGGCTTCCGAGTCAGC -3'

Sequencing Primer
(F):5'- TGTGGCCACAGTACACGG -3'
(R):5'- CGAGTCAGCCACCGTTTTC -3'
Posted On2020-06-30