Incidental Mutation 'R8135:Zfp397'
ID632237
Institutional Source Beutler Lab
Gene Symbol Zfp397
Ensembl Gene ENSMUSG00000024276
Gene Namezinc finger protein 397
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location23954692-23964673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23956507 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 23 (V23E)
Ref Sequence ENSEMBL: ENSMUSP00000057253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060762] [ENSMUST00000225682]
Predicted Effect probably damaging
Transcript: ENSMUST00000060762
AA Change: V23E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057253
Gene: ENSMUSG00000024276
AA Change: V23E

DomainStartEndE-ValueType
SCAN 46 158 4e-68 SMART
ZnF_C2H2 278 300 1.58e-3 SMART
ZnF_C2H2 306 328 7.37e-4 SMART
ZnF_C2H2 334 356 1.22e-4 SMART
ZnF_C2H2 362 384 9.58e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 1.6e-4 SMART
ZnF_C2H2 446 468 4.54e-4 SMART
ZnF_C2H2 474 496 3.49e-5 SMART
ZnF_C2H2 502 524 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000225682
AA Change: V23E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Zfp397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Zfp397 APN 18 23960029 missense probably benign
ANU22:Zfp397 UTSW 18 23960751 missense probably damaging 1.00
R1986:Zfp397 UTSW 18 23960051 missense possibly damaging 0.72
R4676:Zfp397 UTSW 18 23960797 nonsense probably null
R4824:Zfp397 UTSW 18 23960192 missense probably benign 0.02
R5471:Zfp397 UTSW 18 23960024 missense probably benign 0.00
R5735:Zfp397 UTSW 18 23960192 missense possibly damaging 0.76
R7134:Zfp397 UTSW 18 23957065 missense probably benign
R7231:Zfp397 UTSW 18 23960358 missense probably damaging 1.00
R7753:Zfp397 UTSW 18 23957072 missense probably benign 0.00
R8213:Zfp397 UTSW 18 23960722 missense probably damaging 1.00
R8251:Zfp397 UTSW 18 23960304 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTGTAAGTTACAATGCTTTCATG -3'
(R):5'- GCACTAACAGTTCTAGGATCTGC -3'

Sequencing Primer
(F):5'- TGCTTTCATGTATTGTAGGAAAGAAG -3'
(R):5'- TGTGCAACTCTGGCATTAGC -3'
Posted On2020-06-30