Incidental Mutation 'R8136:Map3k19'
ID 632240
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 127815253-127855031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 127823755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 620 (S620A)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect probably damaging
Transcript: ENSMUST00000061512
AA Change: S416A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: S416A

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: S315A

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: S620A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0465:Map3k19 UTSW 1 127838527 missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127817425 missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127823793 missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127817254 missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127822248 nonsense probably null
R7702:Map3k19 UTSW 1 127829090 missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127823646 missense probably benign 0.21
R8129:Map3k19 UTSW 1 127822683 missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127823755 missense probably damaging 0.99
R8264:Map3k19 UTSW 1 127823791 missense
R8305:Map3k19 UTSW 1 127817270 missense
R8511:Map3k19 UTSW 1 127847418 missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127824129 missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127822626 missense probably benign 0.08
R9025:Map3k19 UTSW 1 127830438 missense probably benign 0.06
Z1177:Map3k19 UTSW 1 127822034 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACCACCCCATTCATTTCGGG -3'
(R):5'- GACACTACTCCTACAGAGAGGG -3'

Sequencing Primer
(F):5'- ACCCCATTCATTTCGGGATTTG -3'
(R):5'- GAGAGGACTCCCAATATCTTTCATC -3'
Posted On 2020-06-30