Mutagenetix > Incidental Mutations

Incidental Mutation 'R8136:Ubr3'

632242

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8136 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70021179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1827 (I1827T)

Ref Sequence

ENSEMBL: ENSMUSP00000060159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

AlphaFold

Q5U430

Predicted Effect

probably damaging
Transcript: ENSMUST00000055758
AA Change: I1827T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: I1827T

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112251
AA Change: I1830T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: I1830T

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Meta Mutation Damage Score

0.5436

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,248,397	M2462L	probably benign	Het
Aptx	A	G	4: 40,688,107		probably null	Het
Bmpr1b	A	G	3: 141,856,382	I348T	probably damaging	Het
Btnl1	T	A	17: 34,380,040		probably null	Het
Col27a1	T	A	4: 63,283,953	D960E	probably benign	Het
Crygn	G	T	5: 24,751,092	R172S	probably benign	Het
Cyp26a1	T	C	19: 37,701,206	I450T	probably benign	Het
Emc2	A	G	15: 43,511,806	Y233C	probably benign	Het
Esyt2	C	A	12: 116,363,459	T549K	probably benign	Het
Fam71e1	T	C	7: 44,500,280	F142L	probably damaging	Het
Gatm	T	C	2: 122,595,537	D411G	probably damaging	Het
Gpr65	T	C	12: 98,275,156	Y23H	probably damaging	Het
Itpr1	A	G	6: 108,438,360	R1752G	probably benign	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Mcm9	A	G	10: 53,611,343	*543Q	probably null	Het
Mfsd2a	A	T	4: 122,951,867	C164S	probably benign	Het
Mta1	C	A	12: 113,131,678	R484S	probably damaging	Het
Nlrp9a	T	G	7: 26,557,253	F99V	probably benign	Het
Notch2	G	A	3: 98,124,221	C1137Y	probably damaging	Het
Olfr575	A	T	7: 102,955,241	M120K	probably damaging	Het
Pcnx	A	G	12: 81,918,006	T316A	probably benign	Het
Phf11a	A	G	14: 59,277,569	V221A	probably benign	Het
Pigb	A	G	9: 73,022,320	L327P	possibly damaging	Het
Rab3c	A	T	13: 110,181,020	Y110*	probably null	Het
Sdk2	G	A	11: 113,851,713	T790M	probably damaging	Het
Slc22a2	C	T	17: 12,606,030	P260S	probably damaging	Het
Sppl2a	T	C	2: 126,913,281		probably null	Het
Tmem189	A	C	2: 167,644,959	Y167D	probably benign	Het
Tnn	T	A	1: 160,107,060	Q1261L	probably damaging	Het
Treml4	C	A	17: 48,264,717	Y49*	probably null	Het
Ttc37	A	G	13: 76,113,103	K131R	probably benign	Het
Vrtn	C	T	12: 84,650,035	R520C	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Wls	C	A	3: 159,873,124	Q108K	probably damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp39	A	T	11: 58,891,402	V178D	probably damaging	Het
Zfp777	C	A	6: 48,044,625	R21L	probably benign	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
R8675:Ubr3	UTSW	2	70020521	missense	probably damaging	1.00
R8834:Ubr3	UTSW	2	70003441	missense	probably benign
R8975:Ubr3	UTSW	2	69922307	missense	probably damaging	1.00
R9060:Ubr3	UTSW	2	70009145	nonsense	probably null
R9153:Ubr3	UTSW	2	69965478	missense
R9234:Ubr3	UTSW	2	69897646	missense	probably benign
R9293:Ubr3	UTSW	2	69897425	missense	probably benign	0.02
R9312:Ubr3	UTSW	2	69954333	missense	probably damaging	1.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGTGCTCGCTTCAACG -3'
(R):5'- CAGGCTTACCCATGCATTCC -3'

Sequencing Primer
(F):5'- AACGCTTCTTCATTTATTCATGAGC -3'
(R):5'- TTCTTCAACACACTATGGCAAAG -3'

Posted On

2020-06-30