Incidental Mutation 'R8136:Wipf1'
ID 632243
Institutional Source Beutler Lab
Gene Symbol Wipf1
Ensembl Gene ENSMUSG00000075284
Gene Name WAS/WASL interacting protein family, member 1
Synonyms WIP, D2Ertd120e, Waspip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R8136 (G1)
Quality Score 210.009
Status Validated
Chromosome 2
Chromosomal Location 73429610-73529734 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73437535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 173 (P173L)
Ref Sequence ENSEMBL: ENSMUSP00000092268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094681] [ENSMUST00000102679] [ENSMUST00000102680] [ENSMUST00000141264]
AlphaFold Q8K1I7
Predicted Effect possibly damaging
Transcript: ENSMUST00000094681
AA Change: P173L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092268
Gene: ENSMUSG00000075284
AA Change: P173L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102679
AA Change: P173L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099740
Gene: ENSMUSG00000075284
AA Change: P173L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102680
AA Change: P173L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099741
Gene: ENSMUSG00000075284
AA Change: P173L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141264
AA Change: P173L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119190
Gene: ENSMUSG00000075284
AA Change: P173L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have immunological abnormalities, although lymphocyte development appears normal. Mutants show abnormal B and T cell proliferative responses, high serum immunoglobulin levels and impaired immunological synapse formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Wipf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Wipf1 APN 2 73447881 missense unknown
IGL02391:Wipf1 APN 2 73434143 missense probably damaging 1.00
IGL02992:Wipf1 APN 2 73434083 missense probably damaging 1.00
PIT1430001:Wipf1 UTSW 2 73437602 missense probably damaging 1.00
R1553:Wipf1 UTSW 2 73437526 missense possibly damaging 0.96
R1920:Wipf1 UTSW 2 73440155 missense probably benign 0.11
R3154:Wipf1 UTSW 2 73437490 missense possibly damaging 0.86
R3161:Wipf1 UTSW 2 73434949 missense probably damaging 0.99
R3975:Wipf1 UTSW 2 73437169 missense probably benign 0.00
R4996:Wipf1 UTSW 2 73440074 unclassified probably benign
R5218:Wipf1 UTSW 2 73444468 missense probably damaging 1.00
R6916:Wipf1 UTSW 2 73437404 missense probably damaging 1.00
R7006:Wipf1 UTSW 2 73437097 missense probably damaging 1.00
R7259:Wipf1 UTSW 2 73435081 missense probably damaging 0.99
R7486:Wipf1 UTSW 2 73440074 unclassified probably benign
R7689:Wipf1 UTSW 2 73432445 missense probably damaging 0.98
R7712:Wipf1 UTSW 2 73444461 missense probably damaging 1.00
R8094:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8095:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8120:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8150:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8152:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
Z1177:Wipf1 UTSW 2 73437364 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGGCACTGGAGGTTTGCTG -3'
(R):5'- TCAGTGCTCAGTGGGAAAGG -3'

Sequencing Primer
(F):5'- ACCGCTTCTCTGTGCATGGAG -3'
(R):5'- GGGGGCTCCTCACTTTTCAATC -3'
Posted On 2020-06-30