Incidental Mutation 'R8136:Gatm'
ID 632244
Institutional Source Beutler Lab
Gene Symbol Gatm
Ensembl Gene ENSMUSG00000027199
Gene Name glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonyms 1810003P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 122594467-122611303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122595537 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 411 (D411G)
Ref Sequence ENSEMBL: ENSMUSP00000028624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028624]
AlphaFold Q9D964
Predicted Effect probably damaging
Transcript: ENSMUST00000028624
AA Change: D411G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028624
Gene: ENSMUSG00000027199
AA Change: D411G

DomainStartEndE-ValueType
Pfam:Amidinotransf 254 414 3e-7 PFAM
Meta Mutation Damage Score 0.9669 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that belongs to the amidinotransferase family. This enzyme is involved in creatine biosynthesis, whereby it catalyzes the transfer of a guanido group from L-arginine to glycine, resulting in guanidinoacetic acid, the immediate precursor of creatine. Mutations in this gene cause arginine:glycine amidinotransferase deficiency, an inborn error of creatine synthesis characterized by mental retardation, language impairment, and behavioral disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance obesity, reduced adipocity and improved glucose homeostasis when fed a high fat diet. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Gatm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gatm APN 2 122600825 missense possibly damaging 0.49
IGL03059:Gatm APN 2 122609700 missense probably damaging 1.00
mrbig UTSW 2 122600744 missense probably damaging 1.00
staggering UTSW 2 122595537 missense probably damaging 1.00
Weighted UTSW 2 122609660 splice site probably benign
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R1004:Gatm UTSW 2 122609660 splice site probably benign
R2088:Gatm UTSW 2 122598148 missense probably benign
R2128:Gatm UTSW 2 122600536 missense probably damaging 1.00
R4027:Gatm UTSW 2 122597446 missense probably damaging 1.00
R5155:Gatm UTSW 2 122609853 missense probably benign 0.04
R5183:Gatm UTSW 2 122595503 missense probably benign 0.01
R5517:Gatm UTSW 2 122595543 missense probably damaging 1.00
R5804:Gatm UTSW 2 122602602 missense probably benign 0.01
R5842:Gatm UTSW 2 122603627 missense probably benign
R6362:Gatm UTSW 2 122598196 missense probably benign 0.06
R8199:Gatm UTSW 2 122602513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTTGGAAACCCTGTTAAG -3'
(R):5'- GGCTGGGCTAGATGAAATATAACC -3'

Sequencing Primer
(F):5'- CTGTTAAGGATGTGATTGTTCAAAGC -3'
(R):5'- GGATCTGAACCTCGGTGTTCC -3'
Posted On 2020-06-30