Incidental Mutation 'R8136:Tmem189'
ID 632245
Institutional Source Beutler Lab
Gene Symbol Tmem189
Ensembl Gene ENSMUSG00000090213
Gene Name transmembrane protein 189
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 167642608-167689822 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 167644959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 167 (Y167D)
Ref Sequence ENSEMBL: ENSMUSP00000006587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006587] [ENSMUST00000125544]
AlphaFold Q99LQ7
Predicted Effect probably benign
Transcript: ENSMUST00000006587
AA Change: Y167D

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006587
Gene: ENSMUSG00000090213
AA Change: Y167D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:Kua-UEV1_localn 85 263 4.9e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125544
AA Change: Y167D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118416
Gene: ENSMUSG00000089739
AA Change: Y167D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
UBCc 239 371 1.53e-14 SMART
Meta Mutation Damage Score 0.7891 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Co-transcription of this gene and the neighboring downstream gene (ubiquitin-conjugating enzyme E2 variant 1) generates a rare read-through transcript, which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. The protein encoded by this individual gene lacks a UEV1 domain but includes three transmembrane regions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Tmem189
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0117:Tmem189 UTSW 2 167644758 splice site probably benign
R0505:Tmem189 UTSW 2 167644987 splice site probably benign
R2316:Tmem189 UTSW 2 167654715 missense possibly damaging 0.91
R7097:Tmem189 UTSW 2 167661478 missense probably benign
Z1088:Tmem189 UTSW 2 167644864 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAAGTATGTTTCGTGGGGC -3'
(R):5'- AGAATCAGAAGCCAGCCTGG -3'

Sequencing Primer
(F):5'- GTTTCGTGGGGCGCCAC -3'
(R):5'- CACACTCTTAGCCAATCCCTG -3'
Posted On 2020-06-30