Incidental Mutation 'R8136:Bmpr1b'
ID 632248
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Name bone morphogenetic protein receptor, type 1B
Synonyms BMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission 067564-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.678) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 141837136-142169425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141856382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 348 (I348T)
Ref Sequence ENSEMBL: ENSMUSP00000029948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
AlphaFold P36898
PDB Structure Crystal structure of the GDF-5:BMP receptor IB complex. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029948
AA Change: I348T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: I348T

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098568
AA Change: I348T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: I348T

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106230
AA Change: I348T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: I348T

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106232
AA Change: I348T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: I348T

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
R8933:Bmpr1b UTSW 3 141856608 missense probably damaging 0.99
R8949:Bmpr1b UTSW 3 141880442 missense possibly damaging 0.83
R9675:Bmpr1b UTSW 3 141857560 missense probably benign 0.00
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGACTGACCCAAACAAATGGTC -3'
(R):5'- CATGAAAACGGCTCCCTTTATGAC -3'

Sequencing Primer
(F):5'- GGTCCTTACCAAGAATATCGTGAC -3'
(R):5'- AAAACGGCTCCCTTTATGACTATCTG -3'
Posted On 2020-06-30