Incidental Mutation 'R8136:Wls'
ID 632249
Institutional Source Beutler Lab
Gene Symbol Wls
Ensembl Gene ENSMUSG00000028173
Gene Name wntless WNT ligand secretion mediator
Synonyms 5031439A09Rik, Gpr177
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 159839672-159938664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 159873124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 108 (Q108K)
Ref Sequence ENSEMBL: ENSMUSP00000067898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068952] [ENSMUST00000198878] [ENSMUST00000200191]
AlphaFold Q6DID7
Predicted Effect probably damaging
Transcript: ENSMUST00000068952
AA Change: Q108K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067898
Gene: ENSMUSG00000028173
AA Change: Q108K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 178 496 3.7e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198878
AA Change: Q108K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143475
Gene: ENSMUSG00000028173
AA Change: Q108K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 177 497 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200191
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles exhibit impaired body axis and triploblastic development dying prior to E10.5. Mice homozygous for a floxed allele activated in keratinocytes exhibit a psoriasiform dermatitis-like phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Wls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Wls APN 3 159901443 nonsense probably null
IGL02065:Wls APN 3 159911356 missense probably damaging 0.99
IGL02073:Wls APN 3 159907253 critical splice donor site probably null
IGL02133:Wls APN 3 159897370 missense probably damaging 1.00
R0374:Wls UTSW 3 159897437 nonsense probably null
R0561:Wls UTSW 3 159873068 missense probably benign 0.32
R1697:Wls UTSW 3 159897358 missense probably benign 0.12
R1791:Wls UTSW 3 159911813 missense probably benign 0.17
R2444:Wls UTSW 3 159907230 missense probably damaging 1.00
R3161:Wls UTSW 3 159897436 missense probably damaging 1.00
R4285:Wls UTSW 3 159934266 missense probably benign
R4468:Wls UTSW 3 159872927 missense probably damaging 0.96
R4472:Wls UTSW 3 159897383 missense probably benign 0.01
R4782:Wls UTSW 3 159897445 missense probably benign 0.03
R4799:Wls UTSW 3 159897445 missense probably benign 0.03
R4809:Wls UTSW 3 159897445 missense probably benign 0.03
R5006:Wls UTSW 3 159911791 missense possibly damaging 0.68
R5212:Wls UTSW 3 159873008 missense probably benign 0.15
R5434:Wls UTSW 3 159934340 missense probably damaging 0.97
R5694:Wls UTSW 3 159839987 missense probably benign 0.01
R6315:Wls UTSW 3 159934371 critical splice donor site probably null
R7069:Wls UTSW 3 159934329 missense probably damaging 1.00
R7243:Wls UTSW 3 159909765 missense possibly damaging 0.49
R7529:Wls UTSW 3 159873007 missense probably benign 0.43
R7697:Wls UTSW 3 159911318 missense probably benign 0.21
R7842:Wls UTSW 3 159873179 missense probably benign 0.09
R8536:Wls UTSW 3 159873111 missense probably damaging 0.96
R8816:Wls UTSW 3 159934292 missense possibly damaging 0.89
R9074:Wls UTSW 3 159909766 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGATGTCCGTAAGAACCACC -3'
(R):5'- CCTTTGCAGTCTTGGGTCTGAC -3'

Sequencing Primer
(F):5'- CCATAAAACAAGATGGCTGGC -3'
(R):5'- TCACCAGGATCCAAGCGATATATGTG -3'
Posted On 2020-06-30