Incidental Mutation 'R8136:Aptx'
ID 632250
Institutional Source Beutler Lab
Gene Symbol Aptx
Ensembl Gene ENSMUSG00000028411
Gene Name aprataxin
Synonyms 2410016G21Rik
MMRRC Submission 067564-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 217.009
Status Validated
Chromosome 4
Chromosomal Location 40682382-40703194 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 40688107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030119] [ENSMUST00000068125] [ENSMUST00000108103] [ENSMUST00000129021]
AlphaFold Q7TQC5
Predicted Effect probably null
Transcript: ENSMUST00000030119
SMART Domains Protein: ENSMUSP00000030119
Gene: ENSMUSG00000028411

DomainStartEndE-ValueType
PDB:3KT9|A 1 101 2e-61 PDB
Blast:FHA 24 68 7e-18 BLAST
Pfam:DcpS_C 160 271 3.1e-36 PFAM
Pfam:HIT 167 262 9.2e-17 PFAM
ZnF_C2H2 310 332 2.71e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068125
SMART Domains Protein: ENSMUSP00000124264
Gene: ENSMUSG00000028411

DomainStartEndE-ValueType
PDB:3KT9|A 8 108 2e-61 PDB
Blast:FHA 31 75 7e-18 BLAST
Pfam:DcpS_C 167 278 5.9e-37 PFAM
Pfam:HIT 174 269 1.3e-16 PFAM
ZnF_C2H2 317 339 2.71e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108103
SMART Domains Protein: ENSMUSP00000103738
Gene: ENSMUSG00000028411

DomainStartEndE-ValueType
Blast:FHA 24 59 4e-13 BLAST
Pfam:DcpS_C 65 176 2.2e-36 PFAM
Pfam:HIT 72 167 8.8e-17 PFAM
ZnF_C2H2 215 237 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129021
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in single-strand DNA break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,287,556 (GRCm39) M2462L probably benign Het
Bmpr1b A G 3: 141,562,143 (GRCm39) I348T probably damaging Het
Btnl1 T A 17: 34,599,014 (GRCm39) probably null Het
Col27a1 T A 4: 63,202,190 (GRCm39) D960E probably benign Het
Crygn G T 5: 24,956,090 (GRCm39) R172S probably benign Het
Cyp26a1 T C 19: 37,689,654 (GRCm39) I450T probably benign Het
Emc2 A G 15: 43,375,202 (GRCm39) Y233C probably benign Het
Esyt2 C A 12: 116,327,079 (GRCm39) T549K probably benign Het
Garin5a T C 7: 44,149,704 (GRCm39) F142L probably damaging Het
Gatm T C 2: 122,426,018 (GRCm39) D411G probably damaging Het
Gpr65 T C 12: 98,241,415 (GRCm39) Y23H probably damaging Het
Itpr1 A G 6: 108,415,321 (GRCm39) R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Mcm9 A G 10: 53,487,439 (GRCm39) *543Q probably null Het
Mfsd2a A T 4: 122,845,660 (GRCm39) C164S probably benign Het
Mta1 C A 12: 113,095,298 (GRCm39) R484S probably damaging Het
Nlrp9a T G 7: 26,256,678 (GRCm39) F99V probably benign Het
Notch2 G A 3: 98,031,537 (GRCm39) C1137Y probably damaging Het
Or51a6 A T 7: 102,604,448 (GRCm39) M120K probably damaging Het
Pcnx1 A G 12: 81,964,780 (GRCm39) T316A probably benign Het
Peds1 A C 2: 167,486,879 (GRCm39) Y167D probably benign Het
Phf11a A G 14: 59,515,018 (GRCm39) V221A probably benign Het
Pigb A G 9: 72,929,602 (GRCm39) L327P possibly damaging Het
Rab3c A T 13: 110,317,554 (GRCm39) Y110* probably null Het
Sdk2 G A 11: 113,742,539 (GRCm39) T790M probably damaging Het
Skic3 A G 13: 76,261,222 (GRCm39) K131R probably benign Het
Slc22a2 C T 17: 12,824,917 (GRCm39) P260S probably damaging Het
Sppl2a T C 2: 126,755,201 (GRCm39) probably null Het
Tnn T A 1: 159,934,630 (GRCm39) Q1261L probably damaging Het
Treml4 C A 17: 48,571,745 (GRCm39) Y49* probably null Het
Ubr3 T C 2: 69,851,523 (GRCm39) I1827T probably damaging Het
Vrtn C T 12: 84,696,809 (GRCm39) R520C probably damaging Het
Wipf1 G A 2: 73,267,879 (GRCm39) P173L possibly damaging Het
Wls C A 3: 159,578,761 (GRCm39) Q108K probably damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp39 A T 11: 58,782,228 (GRCm39) V178D probably damaging Het
Zfp777 C A 6: 48,021,559 (GRCm39) R21L probably benign Het
Other mutations in Aptx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Aptx APN 4 40,688,133 (GRCm39) missense probably damaging 1.00
IGL02419:Aptx APN 4 40,691,032 (GRCm39) missense probably benign 0.01
IGL03188:Aptx APN 4 40,695,143 (GRCm39) splice site probably null
IGL02991:Aptx UTSW 4 40,686,687 (GRCm39) missense probably damaging 1.00
R0003:Aptx UTSW 4 40,695,145 (GRCm39) splice site probably benign
R1250:Aptx UTSW 4 40,693,447 (GRCm39) missense probably benign 0.00
R1681:Aptx UTSW 4 40,697,274 (GRCm39) missense probably benign 0.13
R2512:Aptx UTSW 4 40,694,917 (GRCm39) missense probably benign 0.00
R3034:Aptx UTSW 4 40,694,994 (GRCm39) missense probably benign 0.00
R4610:Aptx UTSW 4 40,702,766 (GRCm39) splice site probably null
R6108:Aptx UTSW 4 40,694,986 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGTAGCGACCCTATTACCATG -3'
(R):5'- CACAGCGTCCGAACTGTATG -3'

Sequencing Primer
(F):5'- GACCCTATTACCATGAAACATCTTTG -3'
(R):5'- AACTGTATGTTCCTGTGCTTGC -3'
Posted On 2020-06-30