Incidental Mutation 'R8136:Col27a1'
ID 632251
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Name collagen, type XXVII, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 63214004-63334991 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63283953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 960 (D960E)
Ref Sequence ENSEMBL: ENSMUSP00000043816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300] [ENSMUST00000183913] [ENSMUST00000184067]
AlphaFold Q5QNQ9
Predicted Effect probably benign
Transcript: ENSMUST00000036300
AA Change: D960E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672
AA Change: D960E

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183913
AA Change: D24E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139182
Gene: ENSMUSG00000045672
AA Change: D24E

DomainStartEndE-ValueType
Pfam:Collagen 1 60 2.7e-12 PFAM
Pfam:Collagen 34 114 6.6e-8 PFAM
Pfam:Collagen 87 163 3.6e-9 PFAM
low complexity region 175 202 N/A INTRINSIC
low complexity region 214 232 N/A INTRINSIC
Pfam:Collagen 271 338 9.1e-11 PFAM
Pfam:Collagen 328 388 5.4e-11 PFAM
Pfam:Collagen 387 442 4.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184067
AA Change: D345E
SMART Domains Protein: ENSMUSP00000139173
Gene: ENSMUSG00000045672
AA Change: D345E

DomainStartEndE-ValueType
Pfam:Collagen 23 87 2.1e-8 PFAM
Pfam:Collagen 57 145 8.3e-8 PFAM
Pfam:Collagen 115 200 9.9e-8 PFAM
low complexity region 202 223 N/A INTRINSIC
low complexity region 243 265 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 331 N/A INTRINSIC
internal_repeat_1 337 442 5.17e-20 PROSPERO
Pfam:Collagen 448 515 1.5e-9 PFAM
Pfam:Collagen 478 543 2e-10 PFAM
Pfam:Collagen 502 566 2.5e-9 PFAM
Pfam:Collagen 532 617 4.4e-7 PFAM
Pfam:Collagen 594 660 8.2e-11 PFAM
Pfam:Collagen 649 709 1.4e-10 PFAM
Pfam:Collagen 708 769 2e-12 PFAM
Pfam:Collagen 752 829 5e-8 PFAM
Pfam:Collagen 878 939 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63300741 splice site probably benign
IGL01461:Col27a1 APN 4 63224243 missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63225782 missense probably benign 0.12
IGL01738:Col27a1 APN 4 63263779 splice site probably benign
IGL01810:Col27a1 APN 4 63225631 missense probably benign 0.21
IGL02127:Col27a1 APN 4 63225142 missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63225926 missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63293249 missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63318255 splice site probably benign
IGL02792:Col27a1 APN 4 63315583 missense unknown
IGL02931:Col27a1 APN 4 63331426 utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63324632 splice site probably benign
IGL03121:Col27a1 APN 4 63225209 missense probably benign 0.26
IGL03334:Col27a1 APN 4 63314722 missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63225400 missense probably benign 0.04
R0025:Col27a1 UTSW 4 63275977 missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63265633 critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63224266 missense probably benign 0.02
R0359:Col27a1 UTSW 4 63314727 critical splice donor site probably null
R0375:Col27a1 UTSW 4 63225661 missense probably benign 0.23
R0432:Col27a1 UTSW 4 63225611 missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63300741 splice site probably benign
R0786:Col27a1 UTSW 4 63291578 critical splice donor site probably null
R0891:Col27a1 UTSW 4 63305183 critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63318915 splice site probably benign
R1297:Col27a1 UTSW 4 63265631 splice site probably benign
R1299:Col27a1 UTSW 4 63265631 splice site probably benign
R1322:Col27a1 UTSW 4 63328566 utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63257114 critical splice donor site probably null
R1446:Col27a1 UTSW 4 63224803 missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63329863 utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63328631 utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63225713 missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63331349 utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63283893 splice site probably null
R1957:Col27a1 UTSW 4 63277794 missense probably benign 0.03
R1970:Col27a1 UTSW 4 63273117 splice site probably benign
R2164:Col27a1 UTSW 4 63225424 missense probably benign 0.21
R3774:Col27a1 UTSW 4 63314726 missense probably benign 0.00
R4078:Col27a1 UTSW 4 63224432 missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63225631 missense probably benign 0.21
R4611:Col27a1 UTSW 4 63293506 missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63283913 missense probably benign 0.01
R4884:Col27a1 UTSW 4 63275960 missense possibly damaging 0.77
R5149:Col27a1 UTSW 4 63331427 utr 3 prime probably benign
R5411:Col27a1 UTSW 4 63224665 missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63225239 missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63281114 missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63225310 missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63225528 missense probably damaging 1.00
R6230:Col27a1 UTSW 4 63224282 missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63324441 utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R6624:Col27a1 UTSW 4 63225011 missense probably benign 0.00
R6792:Col27a1 UTSW 4 63317503 missense unknown
R6848:Col27a1 UTSW 4 63302371 missense probably benign
R6962:Col27a1 UTSW 4 63319501 utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63333167 utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63235346 missense probably benign 0.29
R7586:Col27a1 UTSW 4 63225041 missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63225718 missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63324486 critical splice donor site probably null
R7916:Col27a1 UTSW 4 63224552 missense probably damaging 1.00
R7943:Col27a1 UTSW 4 63318283 missense unknown
R7988:Col27a1 UTSW 4 63331322 missense unknown
R8243:Col27a1 UTSW 4 63225883 missense probably damaging 1.00
R8245:Col27a1 UTSW 4 63225803 missense probably damaging 0.97
R8350:Col27a1 UTSW 4 63329897 missense unknown
R8437:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R8450:Col27a1 UTSW 4 63329897 missense unknown
R8542:Col27a1 UTSW 4 63321425 splice site probably null
R8745:Col27a1 UTSW 4 63225916 missense probably benign 0.02
R8821:Col27a1 UTSW 4 63224911 missense probably benign 0.04
R8951:Col27a1 UTSW 4 63273074 missense possibly damaging 0.92
R8970:Col27a1 UTSW 4 63215868 missense unknown
R9115:Col27a1 UTSW 4 63313737 missense unknown
R9185:Col27a1 UTSW 4 63328650 missense unknown
R9291:Col27a1 UTSW 4 63224302 missense probably damaging 0.99
R9404:Col27a1 UTSW 4 63275941 missense not run
Z1176:Col27a1 UTSW 4 63225788 missense probably damaging 0.99
Z1177:Col27a1 UTSW 4 63281289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCACCTAGCTGTAGAGC -3'
(R):5'- GAACAATCCCCTGCTATCGG -3'

Sequencing Primer
(F):5'- GCTGTAGAGCATCTTTGAATTCC -3'
(R):5'- GCTATCGGACACGTAGTCTAC -3'
Posted On 2020-06-30