Incidental Mutation 'R8136:Mfsd2a'
ID 632252
Institutional Source Beutler Lab
Gene Symbol Mfsd2a
Ensembl Gene ENSMUSG00000028655
Gene Name major facilitator superfamily domain containing 2A
Synonyms 1700018O18Rik, Mfsd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 122946850-122961188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122951867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 164 (C164S)
Ref Sequence ENSEMBL: ENSMUSP00000030408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030408] [ENSMUST00000127047]
AlphaFold Q9DA75
Predicted Effect probably benign
Transcript: ENSMUST00000030408
AA Change: C164S

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030408
Gene: ENSMUSG00000028655
AA Change: C164S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
Pfam:MFS_2 44 500 1.7e-96 PFAM
Pfam:MFS_1 57 450 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127047
SMART Domains Protein: ENSMUSP00000116782
Gene: ENSMUSG00000028655

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:MFS_2 42 106 2.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial postnatal lethality, reduced body weight, ataxia, and alterations in lipid metabolism and photoreceptor cell development. Homozygotes for a different null allele show a leaky blood-brain barrier and increased CNS-endothelial-cell vesicular transcytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Mfsd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Mfsd2a APN 4 122949307 missense probably benign 0.32
IGL02756:Mfsd2a APN 4 122948539 missense probably benign 0.30
azure UTSW 4 122952021 missense possibly damaging 0.66
R0355:Mfsd2a UTSW 4 122951839 missense possibly damaging 0.64
R0394:Mfsd2a UTSW 4 122950168 missense probably benign 0.26
R2002:Mfsd2a UTSW 4 122956816 missense probably damaging 1.00
R2516:Mfsd2a UTSW 4 122950487 missense probably damaging 1.00
R2943:Mfsd2a UTSW 4 122948589 missense possibly damaging 0.87
R3052:Mfsd2a UTSW 4 122951842 missense probably damaging 1.00
R4811:Mfsd2a UTSW 4 122959382 missense probably benign 0.28
R4977:Mfsd2a UTSW 4 122950509 missense probably benign
R5030:Mfsd2a UTSW 4 122950156 missense possibly damaging 0.90
R5231:Mfsd2a UTSW 4 122959301 missense possibly damaging 0.88
R5735:Mfsd2a UTSW 4 122949327 missense probably damaging 0.98
R6173:Mfsd2a UTSW 4 122951246 missense probably benign
R6321:Mfsd2a UTSW 4 122949372 missense probably benign 0.06
R6433:Mfsd2a UTSW 4 122950457 missense probably benign 0.01
R6736:Mfsd2a UTSW 4 122951261 missense probably benign
R6793:Mfsd2a UTSW 4 122950705 missense probably benign 0.02
R7073:Mfsd2a UTSW 4 122951295 missense possibly damaging 0.91
R7255:Mfsd2a UTSW 4 122952021 missense possibly damaging 0.66
R7382:Mfsd2a UTSW 4 122952123 missense possibly damaging 0.53
R7868:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
R8095:Mfsd2a UTSW 4 122951271 missense probably damaging 1.00
R8140:Mfsd2a UTSW 4 122949298 missense probably benign 0.00
R8832:Mfsd2a UTSW 4 122949309 missense probably benign 0.01
R8842:Mfsd2a UTSW 4 122951830 missense probably damaging 0.98
R9048:Mfsd2a UTSW 4 122960975 missense probably benign
R9084:Mfsd2a UTSW 4 122950201 missense probably damaging 1.00
Z1176:Mfsd2a UTSW 4 122951839 missense probably benign 0.44
Z1176:Mfsd2a UTSW 4 122959311 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGGCAGTTGACATTTCAGCC -3'
(R):5'- ACGGCTTCCTTTGGTACCTG -3'

Sequencing Primer
(F):5'- TGCTTGACAGACACAAGGCTCTAG -3'
(R):5'- CCTTGGTACCTTGGTGAG -3'
Posted On 2020-06-30