Incidental Mutation 'R8136:Crygn'
ID 632253
Institutional Source Beutler Lab
Gene Symbol Crygn
Ensembl Gene ENSMUSG00000038135
Gene Name crystallin, gamma N
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 24751003-24758008 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24751092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 172 (R172S)
Ref Sequence ENSEMBL: ENSMUSP00000035860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047119]
AlphaFold Q8VHL5
Predicted Effect probably benign
Transcript: ENSMUST00000047119
AA Change: R172S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035860
Gene: ENSMUSG00000038135
AA Change: R172S

DomainStartEndE-ValueType
XTALbg 7 88 1.14e-36 SMART
XTALbg 96 179 5.94e-35 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the crystallin family of proteins that are localized to the refractive structure of vertebrate eye lenses. The protein encoded by this gene is unique in that it has both beta and gamma crystallin protein motifs. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in rhombomeres 3 and 5 derived neurons exhibit reduced MNTB volumne between P4 and P25 with increase in the amplitude of wave IV ABR. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Crygn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0195:Crygn UTSW 5 24756038 missense possibly damaging 0.82
R1199:Crygn UTSW 5 24751148 missense probably damaging 1.00
R4665:Crygn UTSW 5 24751021 utr 3 prime probably benign
R5199:Crygn UTSW 5 24756158 missense probably damaging 0.96
R6268:Crygn UTSW 5 24756191 missense probably damaging 1.00
R7337:Crygn UTSW 5 24756149 missense possibly damaging 0.83
R7832:Crygn UTSW 5 24756074 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTGGCTTCCTTGCTCCAG -3'
(R):5'- ATATCGTCAATCAAGGTAGTGAGG -3'

Sequencing Primer
(F):5'- GCTCCAGCAGGCTTCCTTC -3'
(R):5'- CGTCAATCAAGGTAGTGAGGAGCTAG -3'
Posted On 2020-06-30