Incidental Mutation 'R8136:Fam71e1'
ID 632259
Institutional Source Beutler Lab
Gene Symbol Fam71e1
Ensembl Gene ENSMUSG00000051113
Gene Name family with sequence similarity 71, member E1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44496581-44501486 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44500280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 142 (F142L)
Ref Sequence ENSEMBL: ENSMUSP00000103560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
AlphaFold A1L3C1
Predicted Effect probably damaging
Transcript: ENSMUST00000107927
AA Change: F142L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113
AA Change: F142L

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118515
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118808
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138328
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205359
AA Change: F142L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Fam71e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1355:Fam71e1 UTSW 7 44496691 missense possibly damaging 0.82
R5308:Fam71e1 UTSW 7 44500182 missense probably damaging 1.00
R5568:Fam71e1 UTSW 7 44501004 missense probably damaging 0.99
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R8994:Fam71e1 UTSW 7 44496918 missense probably benign 0.09
RF002:Fam71e1 UTSW 7 44500520 nonsense probably null
RF003:Fam71e1 UTSW 7 44500527 frame shift probably null
RF013:Fam71e1 UTSW 7 44500520 frame shift probably null
RF015:Fam71e1 UTSW 7 44500522 frame shift probably null
RF017:Fam71e1 UTSW 7 44500525 frame shift probably null
RF017:Fam71e1 UTSW 7 44500531 frame shift probably null
RF020:Fam71e1 UTSW 7 44500535 frame shift probably null
RF034:Fam71e1 UTSW 7 44500523 frame shift probably null
RF038:Fam71e1 UTSW 7 44500522 frame shift probably null
RF040:Fam71e1 UTSW 7 44500521 frame shift probably null
RF040:Fam71e1 UTSW 7 44500531 frame shift probably null
RF045:Fam71e1 UTSW 7 44500532 frame shift probably null
RF047:Fam71e1 UTSW 7 44500529 frame shift probably null
RF047:Fam71e1 UTSW 7 44500536 frame shift probably null
RF050:Fam71e1 UTSW 7 44500521 frame shift probably null
RF051:Fam71e1 UTSW 7 44500523 frame shift probably null
RF055:Fam71e1 UTSW 7 44500533 nonsense probably null
RF056:Fam71e1 UTSW 7 44500527 frame shift probably null
RF057:Fam71e1 UTSW 7 44500532 frame shift probably null
RF060:Fam71e1 UTSW 7 44500525 frame shift probably null
RF060:Fam71e1 UTSW 7 44500533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTAGACCATGACTGAGCC -3'
(R):5'- TTCCTTCCTCAGACCCAGAG -3'

Sequencing Primer
(F):5'- TAGACCATGACTGAGCCTCCCC -3'
(R):5'- AACATCCCTGGGCTCGAG -3'
Posted On 2020-06-30