Incidental Mutation 'R8136:Olfr575'
ID 632260
Institutional Source Beutler Lab
Gene Symbol Olfr575
Ensembl Gene ENSMUSG00000066269
Gene Name olfactory receptor 575
Synonyms GA_x6K02T2PBJ9-5666843-5665908, MOR8-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102952270-102958775 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102955241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 120 (M120K)
Ref Sequence ENSEMBL: ENSMUSP00000149993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084812] [ENSMUST00000213477] [ENSMUST00000216420]
AlphaFold Q8VH16
Predicted Effect probably damaging
Transcript: ENSMUST00000084812
AA Change: M127K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081873
Gene: ENSMUSG00000066269
AA Change: M127K

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 4.6e-112 PFAM
Pfam:7TM_GPCR_Srsx 44 312 2.6e-10 PFAM
Pfam:7tm_1 50 300 6.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213477
AA Change: M120K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216420
AA Change: M120K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Olfr575
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr575 APN 7 102955104 missense probably benign 0.01
IGL02583:Olfr575 APN 7 102954711 missense possibly damaging 0.96
R0003:Olfr575 UTSW 7 102954978 missense probably benign
R1553:Olfr575 UTSW 7 102955218 missense possibly damaging 0.87
R1641:Olfr575 UTSW 7 102954968 missense probably benign 0.07
R1993:Olfr575 UTSW 7 102954746 missense probably damaging 1.00
R4279:Olfr575 UTSW 7 102955085 missense probably benign 0.03
R4905:Olfr575 UTSW 7 102955514 missense probably damaging 0.96
R5992:Olfr575 UTSW 7 102955009 missense probably benign 0.25
R6122:Olfr575 UTSW 7 102954804 missense probably damaging 0.99
R6122:Olfr575 UTSW 7 102955530 missense probably benign
R6391:Olfr575 UTSW 7 102955415 missense possibly damaging 0.66
R6685:Olfr575 UTSW 7 102955681 splice site probably null
R7109:Olfr575 UTSW 7 102955253 missense probably damaging 1.00
R7117:Olfr575 UTSW 7 102954978 missense probably benign
R7901:Olfr575 UTSW 7 102955680 critical splice acceptor site probably null
R8299:Olfr575 UTSW 7 102955532 missense probably damaging 1.00
R9063:Olfr575 UTSW 7 102955239 missense probably benign 0.42
Z1177:Olfr575 UTSW 7 102954976 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGCTTCATGACATCCTG -3'
(R):5'- AGGACTGAACCCTCACTCCATG -3'

Sequencing Primer
(F):5'- GCTTCATGACATCCTGATGGAGAC -3'
(R):5'- CACTCCATGCTCCCATGTAC -3'
Posted On 2020-06-30