Incidental Mutation 'R8136:Pigb'
ID 632261
Institutional Source Beutler Lab
Gene Symbol Pigb
Ensembl Gene ENSMUSG00000079469
Gene Name phosphatidylinositol glycan anchor biosynthesis, class B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 73007419-73040378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73022320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 327 (L327P)
Ref Sequence ENSEMBL: ENSMUSP00000096165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098566] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
AlphaFold Q9JJQ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000098566
AA Change: L327P

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469
AA Change: L327P

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183746
AA Change: L327P

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469
AA Change: L327P

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183904
Predicted Effect possibly damaging
Transcript: ENSMUST00000184035
AA Change: L327P

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469
AA Change: L327P

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184389
AA Change: L327P

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469
AA Change: L327P

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene is thought to encode a member of a family of dolichol-phosphate-mannose (Dol-P-Man) dependent mannosyltransferases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Pigb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Pigb APN 9 73022291 missense probably damaging 0.98
IGL01792:Pigb APN 9 73017986 missense probably damaging 1.00
IGL02416:Pigb APN 9 73017432 missense probably benign 0.00
R2396:Pigb UTSW 9 73015271 nonsense probably null
R2914:Pigb UTSW 9 73039778 splice site probably null
R3830:Pigb UTSW 9 73017473 missense probably benign 0.03
R5048:Pigb UTSW 9 73029708 critical splice acceptor site probably null
R5158:Pigb UTSW 9 73022401 missense probably damaging 1.00
R5180:Pigb UTSW 9 73034590 missense probably damaging 0.99
R5385:Pigb UTSW 9 73039545 missense probably benign 0.05
R5866:Pigb UTSW 9 73029684 missense probably damaging 1.00
R7460:Pigb UTSW 9 73038675 missense probably damaging 0.99
R7552:Pigb UTSW 9 73034488 missense probably benign 0.30
R8005:Pigb UTSW 9 73015264 missense unknown
R8525:Pigb UTSW 9 73017527 missense probably damaging 1.00
R8955:Pigb UTSW 9 73038701 missense probably damaging 0.99
R8988:Pigb UTSW 9 73022294 missense probably damaging 1.00
Z1176:Pigb UTSW 9 73034572 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTGAGTAGCACATTTGTTCAC -3'
(R):5'- GACTTAGACTGCTGCCTGAG -3'

Sequencing Primer
(F):5'- GAGTAGCACATTTGTTCACCTGAC -3'
(R):5'- CTTTCACTTGTGCCAGTGGACG -3'
Posted On 2020-06-30