Mutagenetix > Incidental Mutation

Incidental Mutation 'R8136:Mcm9'

632262

Institutional Source

Beutler Lab

Gene Symbol

Mcm9

Ensembl Gene

ENSMUSG00000058298

Gene Name

minichromosome maintenance 9 homologous recombination repair factor

Synonyms

Mcmdc1, 9030408O17Rik

MMRRC Submission

067564-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8136 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53536315-53630439 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 53611343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 543 (*543Q)

Ref Sequence

ENSEMBL: ENSMUSP00000151639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020004] [ENSMUST00000075540] [ENSMUST00000219271] [ENSMUST00000219282] [ENSMUST00000219838]

AlphaFold

Q2KHI9

Predicted Effect

probably benign
Transcript: ENSMUST00000020004

SMART Domains

Protein: ENSMUSP00000020004
Gene: ENSMUSG00000019857

Domain	Start	End	E-Value	Type
Pfam:ASF1_hist_chap	1	154	7.1e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000075540

SMART Domains

Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298

Domain	Start	End	E-Value	Type
low complexity region	22	44	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
low complexity region	81	111	N/A	INTRINSIC
MCM	268	761	9.44e-116	SMART
AAA	500	649	2.43e-6	SMART
coiled coil region	789	817	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1028	N/A	INTRINSIC
low complexity region	1045	1056	N/A	INTRINSIC
low complexity region	1199	1216	N/A	INTRINSIC
low complexity region	1219	1232	N/A	INTRINSIC
low complexity region	1246	1255	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218025

Predicted Effect

probably benign
Transcript: ENSMUST00000218549

Predicted Effect

probably benign
Transcript: ENSMUST00000219271

Predicted Effect

probably benign
Transcript: ENSMUST00000219282

Predicted Effect

probably null
Transcript: ENSMUST00000219838
AA Change: *543Q

Predicted Effect

probably benign
Transcript: ENSMUST00000219841

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,248,397	M2462L	probably benign	Het
Aptx	A	G	4: 40,688,107		probably null	Het
Bmpr1b	A	G	3: 141,856,382	I348T	probably damaging	Het
Btnl1	T	A	17: 34,380,040		probably null	Het
Col27a1	T	A	4: 63,283,953	D960E	probably benign	Het
Crygn	G	T	5: 24,751,092	R172S	probably benign	Het
Cyp26a1	T	C	19: 37,701,206	I450T	probably benign	Het
Emc2	A	G	15: 43,511,806	Y233C	probably benign	Het
Esyt2	C	A	12: 116,363,459	T549K	probably benign	Het
Fam71e1	T	C	7: 44,500,280	F142L	probably damaging	Het
Gatm	T	C	2: 122,595,537	D411G	probably damaging	Het
Gpr65	T	C	12: 98,275,156	Y23H	probably damaging	Het
Itpr1	A	G	6: 108,438,360	R1752G	probably benign	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Mfsd2a	A	T	4: 122,951,867	C164S	probably benign	Het
Mta1	C	A	12: 113,131,678	R484S	probably damaging	Het
Nlrp9a	T	G	7: 26,557,253	F99V	probably benign	Het
Notch2	G	A	3: 98,124,221	C1137Y	probably damaging	Het
Olfr575	A	T	7: 102,955,241	M120K	probably damaging	Het
Pcnx	A	G	12: 81,918,006	T316A	probably benign	Het
Phf11a	A	G	14: 59,277,569	V221A	probably benign	Het
Pigb	A	G	9: 73,022,320	L327P	possibly damaging	Het
Rab3c	A	T	13: 110,181,020	Y110*	probably null	Het
Sdk2	G	A	11: 113,851,713	T790M	probably damaging	Het
Slc22a2	C	T	17: 12,606,030	P260S	probably damaging	Het
Sppl2a	T	C	2: 126,913,281		probably null	Het
Tmem189	A	C	2: 167,644,959	Y167D	probably benign	Het
Tnn	T	A	1: 160,107,060	Q1261L	probably damaging	Het
Treml4	C	A	17: 48,264,717	Y49*	probably null	Het
Ttc37	A	G	13: 76,113,103	K131R	probably benign	Het
Ubr3	T	C	2: 70,021,179	I1827T	probably damaging	Het
Vrtn	C	T	12: 84,650,035	R520C	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Wls	C	A	3: 159,873,124	Q108K	probably damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp39	A	T	11: 58,891,402	V178D	probably damaging	Het
Zfp777	C	A	6: 48,044,625	R21L	probably benign	Het

Other mutations in Mcm9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Mcm9	APN	10	53622973	missense	probably damaging	0.97
IGL00904:Mcm9	APN	10	53622921	missense	possibly damaging	0.89
IGL00943:Mcm9	APN	10	53548589	missense	probably damaging	1.00
IGL01019:Mcm9	APN	10	53629945	missense	probably damaging	1.00
IGL02452:Mcm9	APN	10	53541557	missense	probably damaging	1.00
IGL02481:Mcm9	APN	10	53625937	missense	probably damaging	1.00
IGL02982:Mcm9	APN	10	53625826	missense	probably damaging	0.99
IGL03300:Mcm9	APN	10	53611427	missense	probably damaging	1.00
R0021:Mcm9	UTSW	10	53537901	missense	possibly damaging	0.94
R0117:Mcm9	UTSW	10	53537736	missense	possibly damaging	0.49
R0137:Mcm9	UTSW	10	53563430	missense	possibly damaging	0.95
R0420:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R0499:Mcm9	UTSW	10	53538154	missense	probably benign	0.01
R0543:Mcm9	UTSW	10	53541598	missense	probably damaging	0.97
R0947:Mcm9	UTSW	10	53537501	small deletion	probably benign
R0975:Mcm9	UTSW	10	53538646	nonsense	probably null
R1573:Mcm9	UTSW	10	53548656	missense	probably damaging	0.97
R1726:Mcm9	UTSW	10	53537881	missense	possibly damaging	0.67
R1839:Mcm9	UTSW	10	53541553	missense	probably damaging	0.99
R2050:Mcm9	UTSW	10	53612825	critical splice donor site	probably null
R2113:Mcm9	UTSW	10	53615847	splice site	probably null
R2172:Mcm9	UTSW	10	53548574	missense	probably damaging	1.00
R3417:Mcm9	UTSW	10	53537407	missense	possibly damaging	0.83
R3755:Mcm9	UTSW	10	53625952	missense	probably benign	0.08
R3787:Mcm9	UTSW	10	53615980	missense	possibly damaging	0.78
R3789:Mcm9	UTSW	10	53616017	missense	probably damaging	1.00
R3953:Mcm9	UTSW	10	53563344	missense	probably damaging	1.00
R4291:Mcm9	UTSW	10	53547572	missense	probably benign	0.22
R4358:Mcm9	UTSW	10	53537653	missense	probably benign	0.03
R4660:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R4662:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R5082:Mcm9	UTSW	10	53538060	missense	possibly damaging	0.94
R5130:Mcm9	UTSW	10	53630399	missense	possibly damaging	0.90
R5193:Mcm9	UTSW	10	53616038	missense	probably damaging	0.99
R5238:Mcm9	UTSW	10	53629997	missense	possibly damaging	0.83
R5317:Mcm9	UTSW	10	53538234	missense	probably damaging	1.00
R5395:Mcm9	UTSW	10	53538692	missense	possibly damaging	0.93
R5524:Mcm9	UTSW	10	53548690	nonsense	probably null
R5593:Mcm9	UTSW	10	53538297	missense	probably damaging	0.99
R5748:Mcm9	UTSW	10	53625729	missense	probably damaging	1.00
R6025:Mcm9	UTSW	10	53615977	missense	possibly damaging	0.93
R6299:Mcm9	UTSW	10	53537681	missense	probably damaging	1.00
R6344:Mcm9	UTSW	10	53537937	missense	probably benign	0.03
R6502:Mcm9	UTSW	10	53612839	missense	probably damaging	1.00
R6621:Mcm9	UTSW	10	53563313	missense	probably damaging	1.00
R6883:Mcm9	UTSW	10	53616014	missense	probably damaging	1.00
R6932:Mcm9	UTSW	10	53620203	missense	probably benign	0.06
R6963:Mcm9	UTSW	10	53548617	missense	probably damaging	1.00
R7094:Mcm9	UTSW	10	53620157	missense	probably damaging	1.00
R7114:Mcm9	UTSW	10	53538573	missense	possibly damaging	0.55
R7200:Mcm9	UTSW	10	53615923	missense
R7593:Mcm9	UTSW	10	53629992	missense	probably benign	0.04
R7671:Mcm9	UTSW	10	53537569	missense	probably benign	0.01
R7697:Mcm9	UTSW	10	53615894	missense
R7997:Mcm9	UTSW	10	53597406	start gained	probably benign
R8137:Mcm9	UTSW	10	53622980	missense
R8494:Mcm9	UTSW	10	53625760	missense	possibly damaging	0.48
R8526:Mcm9	UTSW	10	53630125	unclassified	probably benign
R8558:Mcm9	UTSW	10	53615972	missense	probably benign	0.07
R8703:Mcm9	UTSW	10	53629977	missense	probably damaging	0.96
R8836:Mcm9	UTSW	10	53626034	missense
R8994:Mcm9	UTSW	10	53548524	missense	probably benign	0.31
R9150:Mcm9	UTSW	10	53626014	missense
R9564:Mcm9	UTSW	10	53630008	missense	possibly damaging	0.90
Z1176:Mcm9	UTSW	10	53537507	missense	unknown
Z1176:Mcm9	UTSW	10	53629788	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAAATTCCATACGGAGGACATAGACC -3'
(R):5'- GGCATTTCATATGGTCTACTTTCTG -3'

Sequencing Primer
(F):5'- CCATACGGAGGACATAGACCTTTTTG -3'
(R):5'- TTTCTAGGGGAATCTCACC -3'

Posted On

2020-06-30