Mutagenetix > Incidental Mutations

Incidental Mutation 'R8136:Zfp39'

632263

Institutional Source

Beutler Lab

Gene Symbol

Zfp39

Ensembl Gene

ENSMUSG00000037001

Gene Name

zinc finger protein 39

Synonyms

Zfp-39, CTfin33

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R8136 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58888153-58904225 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58891402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 178 (V178D)

Ref Sequence

ENSEMBL: ENSMUSP00000099764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102703]

AlphaFold

Q02525

Predicted Effect

probably damaging
Transcript: ENSMUST00000102703
AA Change: V178D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: V178D

Domain	Start	End	E-Value	Type
KRAB	59	119	8.23e-34	SMART
low complexity region	171	180	N/A	INTRINSIC
ZnF_C2H2	298	320	9.58e-3	SMART
ZnF_C2H2	326	347	2.2e2	SMART
ZnF_C2H2	353	373	1.18e2	SMART
ZnF_C2H2	409	431	8.34e-3	SMART
ZnF_C2H2	437	459	7.26e-3	SMART
ZnF_C2H2	465	487	1.53e-1	SMART
ZnF_C2H2	493	515	9.08e-4	SMART
ZnF_C2H2	521	543	2.61e-4	SMART
ZnF_C2H2	549	571	1.12e-3	SMART
ZnF_C2H2	577	599	4.94e-5	SMART
ZnF_C2H2	605	627	5.14e-3	SMART
ZnF_C2H2	633	655	1.38e-3	SMART
ZnF_C2H2	661	683	6.78e-3	SMART
ZnF_C2H2	689	711	5.14e-3	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,248,397	M2462L	probably benign	Het
Aptx	A	G	4: 40,688,107		probably null	Het
Bmpr1b	A	G	3: 141,856,382	I348T	probably damaging	Het
Btnl1	T	A	17: 34,380,040		probably null	Het
Col27a1	T	A	4: 63,283,953	D960E	probably benign	Het
Crygn	G	T	5: 24,751,092	R172S	probably benign	Het
Cyp26a1	T	C	19: 37,701,206	I450T	probably benign	Het
Emc2	A	G	15: 43,511,806	Y233C	probably benign	Het
Esyt2	C	A	12: 116,363,459	T549K	probably benign	Het
Fam71e1	T	C	7: 44,500,280	F142L	probably damaging	Het
Gatm	T	C	2: 122,595,537	D411G	probably damaging	Het
Gpr65	T	C	12: 98,275,156	Y23H	probably damaging	Het
Itpr1	A	G	6: 108,438,360	R1752G	probably benign	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Mcm9	A	G	10: 53,611,343	*543Q	probably null	Het
Mfsd2a	A	T	4: 122,951,867	C164S	probably benign	Het
Mta1	C	A	12: 113,131,678	R484S	probably damaging	Het
Nlrp9a	T	G	7: 26,557,253	F99V	probably benign	Het
Notch2	G	A	3: 98,124,221	C1137Y	probably damaging	Het
Olfr575	A	T	7: 102,955,241	M120K	probably damaging	Het
Pcnx	A	G	12: 81,918,006	T316A	probably benign	Het
Phf11a	A	G	14: 59,277,569	V221A	probably benign	Het
Pigb	A	G	9: 73,022,320	L327P	possibly damaging	Het
Rab3c	A	T	13: 110,181,020	Y110*	probably null	Het
Sdk2	G	A	11: 113,851,713	T790M	probably damaging	Het
Slc22a2	C	T	17: 12,606,030	P260S	probably damaging	Het
Sppl2a	T	C	2: 126,913,281		probably null	Het
Tmem189	A	C	2: 167,644,959	Y167D	probably benign	Het
Tnn	T	A	1: 160,107,060	Q1261L	probably damaging	Het
Treml4	C	A	17: 48,264,717	Y49*	probably null	Het
Ttc37	A	G	13: 76,113,103	K131R	probably benign	Het
Ubr3	T	C	2: 70,021,179	I1827T	probably damaging	Het
Vrtn	C	T	12: 84,650,035	R520C	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Wls	C	A	3: 159,873,124	Q108K	probably damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp777	C	A	6: 48,044,625	R21L	probably benign	Het

Other mutations in Zfp39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Zfp39	APN	11	58893059	splice site	probably benign
IGL01597:Zfp39	APN	11	58891543	missense	probably damaging	0.96
IGL02055:Zfp39	APN	11	58891330	missense	probably benign
IGL02456:Zfp39	APN	11	58902800	nonsense	probably null
IGL02873:Zfp39	APN	11	58891022	missense	probably benign	0.12
H8562:Zfp39	UTSW	11	58900686	missense	probably damaging	1.00
R0462:Zfp39	UTSW	11	58890406	missense	probably benign	0.03
R0513:Zfp39	UTSW	11	58889987	missense	probably benign	0.09
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1401:Zfp39	UTSW	11	58890323	missense	probably benign	0.01
R1797:Zfp39	UTSW	11	58900660	missense	probably damaging	0.96
R2146:Zfp39	UTSW	11	58890332	missense	probably benign	0.05
R3903:Zfp39	UTSW	11	58890175	missense	probably benign	0.44
R4303:Zfp39	UTSW	11	58890017	missense	probably damaging	1.00
R4706:Zfp39	UTSW	11	58902807	missense	probably benign	0.41
R4957:Zfp39	UTSW	11	58891231	missense	possibly damaging	0.63
R5092:Zfp39	UTSW	11	58891202	missense	possibly damaging	0.71
R5158:Zfp39	UTSW	11	58889845	missense	possibly damaging	0.81
R5292:Zfp39	UTSW	11	58900589	missense	probably damaging	0.97
R5697:Zfp39	UTSW	11	58889835	missense	probably benign	0.08
R5906:Zfp39	UTSW	11	58902891	missense	probably benign
R5925:Zfp39	UTSW	11	58891273	missense	possibly damaging	0.94
R6174:Zfp39	UTSW	11	58891387	missense	probably benign	0.01
R6177:Zfp39	UTSW	11	58891061	missense	probably benign	0.27
R6968:Zfp39	UTSW	11	58891480	missense	probably benign	0.00
R7045:Zfp39	UTSW	11	58890443	missense	unknown
R7139:Zfp39	UTSW	11	58890559	missense	probably damaging	1.00
R7421:Zfp39	UTSW	11	58890107	missense	probably damaging	1.00
R7493:Zfp39	UTSW	11	58891043	missense	possibly damaging	0.82
R7689:Zfp39	UTSW	11	58890643	missense	probably damaging	1.00
R8061:Zfp39	UTSW	11	58902747	missense	probably benign
R8955:Zfp39	UTSW	11	58890120	nonsense	probably null
Z1186:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1186:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1186:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1186:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1186:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1186:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1186:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1186:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1186:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1186:Zfp39	UTSW	11	58891297	missense	probably benign
Z1186:Zfp39	UTSW	11	58891316	missense	probably benign
Z1186:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1187:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1187:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1187:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1187:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1187:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1187:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1187:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1187:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1187:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1187:Zfp39	UTSW	11	58891297	missense	probably benign
Z1187:Zfp39	UTSW	11	58891316	missense	probably benign
Z1187:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1188:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1188:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1188:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1188:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1188:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1188:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1188:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1188:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1188:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1188:Zfp39	UTSW	11	58891297	missense	probably benign
Z1188:Zfp39	UTSW	11	58891316	missense	probably benign
Z1188:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1189:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1189:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1189:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1189:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1189:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1189:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1189:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1189:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1189:Zfp39	UTSW	11	58891297	missense	probably benign
Z1189:Zfp39	UTSW	11	58891316	missense	probably benign
Z1189:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1190:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1190:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1190:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1190:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1190:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1190:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1190:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1190:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1190:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1190:Zfp39	UTSW	11	58891297	missense	probably benign
Z1190:Zfp39	UTSW	11	58891316	missense	probably benign
Z1190:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1191:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1191:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1191:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1191:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1191:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1191:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1191:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1191:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1191:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1191:Zfp39	UTSW	11	58891297	missense	probably benign
Z1191:Zfp39	UTSW	11	58891316	missense	probably benign
Z1191:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1192:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1192:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1192:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1192:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1192:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1192:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1192:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1192:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1192:Zfp39	UTSW	11	58891297	missense	probably benign
Z1192:Zfp39	UTSW	11	58891316	missense	probably benign
Z1192:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58900583	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGCATACAACACTGAAACTGC -3'
(R):5'- CTGTAACATGAGCTTGGCGAC -3'

Sequencing Primer
(F):5'- GCCTGGAGCTCTGCTATACAAC -3'
(R):5'- TGGCACCATGCAATTACC -3'

Posted On

2020-06-30