Incidental Mutation 'R8136:Zfp39'
ID 632263
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Name zinc finger protein 39
Synonyms Zfp-39, CTfin33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58888153-58904225 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58891402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 178 (V178D)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
AlphaFold Q02525
Predicted Effect probably damaging
Transcript: ENSMUST00000102703
AA Change: V178D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: V178D

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58890107 missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58891043 missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58890643 missense probably damaging 1.00
R8061:Zfp39 UTSW 11 58902747 missense probably benign
R8955:Zfp39 UTSW 11 58890120 nonsense probably null
Z1186:Zfp39 UTSW 11 58890045 nonsense probably null
Z1186:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1186:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58891297 missense probably benign
Z1186:Zfp39 UTSW 11 58891316 missense probably benign
Z1186:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890045 nonsense probably null
Z1187:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1187:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58891297 missense probably benign
Z1187:Zfp39 UTSW 11 58891316 missense probably benign
Z1187:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890045 nonsense probably null
Z1188:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1188:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58891297 missense probably benign
Z1188:Zfp39 UTSW 11 58891316 missense probably benign
Z1188:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890045 nonsense probably null
Z1189:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58891297 missense probably benign
Z1189:Zfp39 UTSW 11 58891316 missense probably benign
Z1189:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890045 nonsense probably null
Z1190:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58891297 missense probably benign
Z1190:Zfp39 UTSW 11 58891316 missense probably benign
Z1190:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890045 nonsense probably null
Z1191:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1191:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58891297 missense probably benign
Z1191:Zfp39 UTSW 11 58891316 missense probably benign
Z1191:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890045 nonsense probably null
Z1192:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58891297 missense probably benign
Z1192:Zfp39 UTSW 11 58891316 missense probably benign
Z1192:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCATACAACACTGAAACTGC -3'
(R):5'- CTGTAACATGAGCTTGGCGAC -3'

Sequencing Primer
(F):5'- GCCTGGAGCTCTGCTATACAAC -3'
(R):5'- TGGCACCATGCAATTACC -3'
Posted On 2020-06-30