Incidental Mutation 'R8136:Vrtn'
ID 632267
Institutional Source Beutler Lab
Gene Symbol Vrtn
Ensembl Gene ENSMUSG00000071235
Gene Name vertebrae development associated
Synonyms 7420416P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 84641019-84651455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84650035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 520 (R520C)
Ref Sequence ENSEMBL: ENSMUSP00000093207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095551] [ENSMUST00000166772] [ENSMUST00000167227] [ENSMUST00000221915] [ENSMUST00000222319]
AlphaFold Q3SYK4
Predicted Effect probably damaging
Transcript: ENSMUST00000095551
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093207
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000166772
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128808
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000167227
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132050
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000221915
Predicted Effect probably benign
Transcript: ENSMUST00000222319
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Vrtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Vrtn APN 12 84649063 missense probably benign 0.01
IGL01777:Vrtn APN 12 84648922 missense probably benign 0.13
IGL01911:Vrtn APN 12 84650206 missense probably benign
IGL02219:Vrtn APN 12 84648833 missense probably damaging 1.00
IGL02684:Vrtn APN 12 84650149 missense probably benign
IGL02947:Vrtn APN 12 84648484 missense probably damaging 0.98
IGL03296:Vrtn APN 12 84648848 missense probably damaging 1.00
PIT4378001:Vrtn UTSW 12 84649169 missense probably damaging 0.99
R0044:Vrtn UTSW 12 84648605 missense probably damaging 1.00
R1546:Vrtn UTSW 12 84648508 missense probably damaging 1.00
R1584:Vrtn UTSW 12 84650081 missense probably damaging 1.00
R1693:Vrtn UTSW 12 84648655 missense probably benign 0.03
R1773:Vrtn UTSW 12 84650224 missense probably damaging 0.98
R1951:Vrtn UTSW 12 84649199 missense probably damaging 1.00
R2143:Vrtn UTSW 12 84650162 missense probably benign 0.00
R4044:Vrtn UTSW 12 84649070 missense probably damaging 1.00
R4777:Vrtn UTSW 12 84648826 missense probably damaging 1.00
R4835:Vrtn UTSW 12 84649694 missense probably damaging 0.97
R5076:Vrtn UTSW 12 84649474 missense probably damaging 1.00
R5783:Vrtn UTSW 12 84650477 missense probably benign 0.31
R5831:Vrtn UTSW 12 84648575 missense probably damaging 1.00
R6349:Vrtn UTSW 12 84649018 missense probably damaging 1.00
R6499:Vrtn UTSW 12 84650316 missense probably benign 0.01
R6931:Vrtn UTSW 12 84650242 missense probably benign
R7192:Vrtn UTSW 12 84648862 missense probably damaging 0.98
R7789:Vrtn UTSW 12 84650306 missense probably benign
R8059:Vrtn UTSW 12 84649916 missense probably benign
R8095:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8096:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8142:Vrtn UTSW 12 84650621 missense probably damaging 1.00
R8557:Vrtn UTSW 12 84649916 missense probably benign
R9165:Vrtn UTSW 12 84650477 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTTGAAACTGCTGAGTCTCTCC -3'
(R):5'- GTGGTTCAACTGGCTTCTGC -3'

Sequencing Primer
(F):5'- TGAGTCTCTCCAGCCAACAGATG -3'
(R):5'- GGGCTTCTGCTGTTCCTCG -3'
Posted On 2020-06-30