Incidental Mutation 'R8136:Gpr65'
ID 632268
Institutional Source Beutler Lab
Gene Symbol Gpr65
Ensembl Gene ENSMUSG00000021886
Gene Name G-protein coupled receptor 65
Synonyms TDAG8, Gpcr25, Dig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 98268635-98276644 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98275156 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 23 (Y23H)
Ref Sequence ENSEMBL: ENSMUSP00000074581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075072]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075072
AA Change: Y23H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074581
Gene: ENSMUSG00000021886
AA Change: Y23H

DomainStartEndE-ValueType
Pfam:7tm_1 33 290 1.9e-41 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygous mutant mice have thymocytes and splenocytes that are insensitive to pH-dependent cAMP production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Gpr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Gpr65 APN 12 98275556 missense probably damaging 1.00
IGL00717:Gpr65 APN 12 98276055 missense probably benign 0.09
IGL01643:Gpr65 APN 12 98275754 missense probably damaging 1.00
IGL01942:Gpr65 APN 12 98275715 missense possibly damaging 0.93
IGL02023:Gpr65 APN 12 98275868 missense probably benign 0.25
IGL02803:Gpr65 APN 12 98275210 missense probably damaging 1.00
R1343:Gpr65 UTSW 12 98275629 missense probably benign 0.00
R1520:Gpr65 UTSW 12 98275175 missense probably benign 0.01
R1771:Gpr65 UTSW 12 98276000 missense probably damaging 0.96
R1812:Gpr65 UTSW 12 98275742 missense probably damaging 1.00
R2261:Gpr65 UTSW 12 98275235 missense probably damaging 1.00
R2263:Gpr65 UTSW 12 98275235 missense probably damaging 1.00
R5720:Gpr65 UTSW 12 98275102 missense probably damaging 1.00
R7458:Gpr65 UTSW 12 98276065 missense probably damaging 0.99
R9376:Gpr65 UTSW 12 98275264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTCTCTAAATGCATGGATG -3'
(R):5'- CTTTGCACAAGGTGGGAGAG -3'

Sequencing Primer
(F):5'- CACTCTCTAAATGCATGGATGAACTC -3'
(R):5'- GAGAAAGTCCAGTTGTCTTTATTCC -3'
Posted On 2020-06-30