Incidental Mutation 'R8136:Mta1'
ID 632269
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113098278-113137206 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113131678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 484 (R484S)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
AlphaFold Q8K4B0
Predicted Effect probably damaging
Transcript: ENSMUST00000009099
AA Change: R484S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: R484S

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: R467S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: R467S

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: R484S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: R484S

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: R467S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: R467S

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: R484S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: R484S

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 splice site probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
R7889:Mta1 UTSW 12 113131688 missense probably benign 0.02
R8176:Mta1 UTSW 12 113120836 missense probably benign 0.00
R8385:Mta1 UTSW 12 113131465 missense probably benign
R8398:Mta1 UTSW 12 113131622 missense possibly damaging 0.83
R9132:Mta1 UTSW 12 113136405 missense probably damaging 1.00
R9159:Mta1 UTSW 12 113136405 missense probably damaging 1.00
R9418:Mta1 UTSW 12 113131367 missense not run
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCGCAATAACATGGTAAGTGGG -3'
(R):5'- GTGAAGAACCATGTTCCCCAAG -3'

Sequencing Primer
(F):5'- TGGGACACACCATACTGATCTG -3'
(R):5'- GAACCTGTACCCCAACCTGG -3'
Posted On 2020-06-30