Incidental Mutation 'R8136:Esyt2'
ID 632270
Institutional Source Beutler Lab
Gene Symbol Esyt2
Ensembl Gene ENSMUSG00000021171
Gene Name extended synaptotagmin-like protein 2
Synonyms 4921504I16Rik, D12Ertd551e, 2410017M09Rik, Fam62b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116281196-116391050 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 116363459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 549 (T549K)
Ref Sequence ENSEMBL: ENSMUSP00000098548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100986] [ENSMUST00000220720] [ENSMUST00000220816]
AlphaFold Q3TZZ7
Predicted Effect probably benign
Transcript: ENSMUST00000100986
AA Change: T549K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098548
Gene: ENSMUSG00000021171
AA Change: T549K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:SMP_LBD 115 294 3e-125 PFAM
C2 310 412 1.39e-14 SMART
C2 461 556 2.59e-14 SMART
low complexity region 660 669 N/A INTRINSIC
C2 726 831 5.51e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220720
Predicted Effect probably benign
Transcript: ENSMUST00000220816
AA Change: T549K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects except reduced FGF-stimulated mouse embryonic fibroblast migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Esyt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Esyt2 APN 12 116363444 missense probably damaging 1.00
IGL01636:Esyt2 APN 12 116365930 critical splice donor site probably null
IGL01912:Esyt2 APN 12 116339609 missense probably damaging 1.00
IGL02310:Esyt2 APN 12 116365921 missense probably benign 0.06
PIT4802001:Esyt2 UTSW 12 116365837 missense probably benign 0.00
R0134:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0225:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0313:Esyt2 UTSW 12 116347808 missense probably damaging 1.00
R0532:Esyt2 UTSW 12 116357198 splice site probably benign
R2324:Esyt2 UTSW 12 116367821 missense possibly damaging 0.50
R4610:Esyt2 UTSW 12 116318890 missense probably damaging 0.99
R4898:Esyt2 UTSW 12 116342088 missense probably benign 0.06
R4918:Esyt2 UTSW 12 116324140 missense probably benign 0.30
R5052:Esyt2 UTSW 12 116367796 missense probably damaging 1.00
R5222:Esyt2 UTSW 12 116318826 missense probably damaging 1.00
R5800:Esyt2 UTSW 12 116370188 missense possibly damaging 0.94
R6499:Esyt2 UTSW 12 116321170 missense probably damaging 0.98
R6607:Esyt2 UTSW 12 116368740 missense probably benign 0.18
R6951:Esyt2 UTSW 12 116324130 missense probably benign 0.21
R7153:Esyt2 UTSW 12 116346508 missense probably benign 0.00
R7173:Esyt2 UTSW 12 116363534 missense probably benign 0.05
R7227:Esyt2 UTSW 12 116342125 missense probably damaging 1.00
R7248:Esyt2 UTSW 12 116342238 missense probably damaging 1.00
R7509:Esyt2 UTSW 12 116365876 missense probably damaging 1.00
R7780:Esyt2 UTSW 12 116342098 missense probably benign 0.15
R8077:Esyt2 UTSW 12 116342228 missense possibly damaging 0.54
R8264:Esyt2 UTSW 12 116365920 missense probably benign 0.00
R8350:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
R8450:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
R9330:Esyt2 UTSW 12 116342145 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTAACAGTTTTGGACACACTAC -3'
(R):5'- TGCCTGTAGAACCACCTCTG -3'

Sequencing Primer
(F):5'- ACATATTGTGTTTTCTTTTGTGCTG -3'
(R):5'- TCTGCAAGGCTGGGACTGAG -3'
Posted On 2020-06-30