Mutagenetix > Incidental Mutations

Incidental Mutation 'R8136:Ttc37'

632271

Institutional Source

Beutler Lab

Gene Symbol

Ttc37

Ensembl Gene

ENSMUSG00000033991

Gene Name

tetratricopeptide repeat domain 37

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R8136 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76098734-76190316 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76113103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 131 (K131R)

Ref Sequence

ENSEMBL: ENSMUSP00000089045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]

AlphaFold

F8VPK0

Predicted Effect

probably benign
Transcript: ENSMUST00000091466
AA Change: K131R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: K131R

Domain	Start	End	E-Value	Type
TPR	6	39	2.92e1	SMART
TPR	40	73	1.1e-1	SMART
TPR	272	305	9.45e0	SMART
TPR	306	339	8.9e-2	SMART
SEL1	420	451	1.45e2	SMART
TPR	420	453	2.55e-2	SMART
SEL1	454	490	1.15e1	SMART
TPR	454	492	2.84e1	SMART
TPR	493	527	1.92e1	SMART
TPR	564	597	7.34e-3	SMART
TPR	598	631	1.81e-2	SMART
TPR	632	665	2.43e1	SMART
low complexity region	728	739	N/A	INTRINSIC
SEL1	861	892	3.58e1	SMART
TPR	861	894	2.14e-4	SMART
TPR	980	1013	1.56e1	SMART
Blast:TPR	1051	1084	7e-11	BLAST
Blast:TPR	1088	1121	7e-10	BLAST
TPR	1399	1432	4.31e0	SMART
low complexity region	1438	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224386
AA Change: K131R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000224790

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,248,397	M2462L	probably benign	Het
Aptx	A	G	4: 40,688,107		probably null	Het
Bmpr1b	A	G	3: 141,856,382	I348T	probably damaging	Het
Btnl1	T	A	17: 34,380,040		probably null	Het
Col27a1	T	A	4: 63,283,953	D960E	probably benign	Het
Crygn	G	T	5: 24,751,092	R172S	probably benign	Het
Cyp26a1	T	C	19: 37,701,206	I450T	probably benign	Het
Emc2	A	G	15: 43,511,806	Y233C	probably benign	Het
Esyt2	C	A	12: 116,363,459	T549K	probably benign	Het
Fam71e1	T	C	7: 44,500,280	F142L	probably damaging	Het
Gatm	T	C	2: 122,595,537	D411G	probably damaging	Het
Gpr65	T	C	12: 98,275,156	Y23H	probably damaging	Het
Itpr1	A	G	6: 108,438,360	R1752G	probably benign	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Mcm9	A	G	10: 53,611,343	*543Q	probably null	Het
Mfsd2a	A	T	4: 122,951,867	C164S	probably benign	Het
Mta1	C	A	12: 113,131,678	R484S	probably damaging	Het
Nlrp9a	T	G	7: 26,557,253	F99V	probably benign	Het
Notch2	G	A	3: 98,124,221	C1137Y	probably damaging	Het
Olfr575	A	T	7: 102,955,241	M120K	probably damaging	Het
Pcnx	A	G	12: 81,918,006	T316A	probably benign	Het
Phf11a	A	G	14: 59,277,569	V221A	probably benign	Het
Pigb	A	G	9: 73,022,320	L327P	possibly damaging	Het
Rab3c	A	T	13: 110,181,020	Y110*	probably null	Het
Sdk2	G	A	11: 113,851,713	T790M	probably damaging	Het
Slc22a2	C	T	17: 12,606,030	P260S	probably damaging	Het
Sppl2a	T	C	2: 126,913,281		probably null	Het
Tmem189	A	C	2: 167,644,959	Y167D	probably benign	Het
Tnn	T	A	1: 160,107,060	Q1261L	probably damaging	Het
Treml4	C	A	17: 48,264,717	Y49*	probably null	Het
Ubr3	T	C	2: 70,021,179	I1827T	probably damaging	Het
Vrtn	C	T	12: 84,650,035	R520C	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Wls	C	A	3: 159,873,124	Q108K	probably damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp39	A	T	11: 58,891,402	V178D	probably damaging	Het
Zfp777	C	A	6: 48,044,625	R21L	probably benign	Het

Other mutations in Ttc37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ttc37	APN	13	76143278	critical splice donor site	probably null
IGL00650:Ttc37	APN	13	76127507	missense	possibly damaging	0.89
IGL00838:Ttc37	APN	13	76134791	missense	probably damaging	0.99
IGL00958:Ttc37	APN	13	76122745	missense	probably damaging	0.98
IGL01011:Ttc37	APN	13	76122665	missense	probably damaging	0.97
IGL01062:Ttc37	APN	13	76155462	nonsense	probably null
IGL01319:Ttc37	APN	13	76129379	missense	probably benign	0.29
IGL01697:Ttc37	APN	13	76128733	missense	probably benign	0.01
IGL02061:Ttc37	APN	13	76129541	critical splice donor site	probably null
IGL02184:Ttc37	APN	13	76111691	missense	probably damaging	1.00
IGL02309:Ttc37	APN	13	76127047	missense	possibly damaging	0.90
IGL03230:Ttc37	APN	13	76155647	splice site	probably benign
IGL03354:Ttc37	APN	13	76182822	missense	possibly damaging	0.71
caviar	UTSW	13	76147767	missense	possibly damaging	0.54
gourmet	UTSW	13	76150519	missense	probably damaging	1.00
tartare	UTSW	13	76185179	missense	probably damaging	0.96
R0501:Ttc37	UTSW	13	76147806	missense	probably benign
R0628:Ttc37	UTSW	13	76150729	missense	possibly damaging	0.89
R0711:Ttc37	UTSW	13	76182891	missense	probably damaging	1.00
R0928:Ttc37	UTSW	13	76113592	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1524:Ttc37	UTSW	13	76138372	missense	probably benign	0.01
R1628:Ttc37	UTSW	13	76111791	missense	possibly damaging	0.75
R1702:Ttc37	UTSW	13	76122743	missense	possibly damaging	0.66
R1750:Ttc37	UTSW	13	76140601	missense	possibly damaging	0.89
R1822:Ttc37	UTSW	13	76130288	missense	probably benign	0.35
R1885:Ttc37	UTSW	13	76113047	missense	probably benign	0.00
R1885:Ttc37	UTSW	13	76130235	missense	probably benign	0.11
R1923:Ttc37	UTSW	13	76134770	missense	probably damaging	1.00
R1978:Ttc37	UTSW	13	76134815	missense	probably benign	0.00
R2040:Ttc37	UTSW	13	76180103	missense	probably damaging	1.00
R2136:Ttc37	UTSW	13	76173354	missense	possibly damaging	0.87
R2268:Ttc37	UTSW	13	76112274	unclassified	probably benign
R2483:Ttc37	UTSW	13	76182867	missense	probably damaging	1.00
R2988:Ttc37	UTSW	13	76155689	missense	probably benign	0.11
R3701:Ttc37	UTSW	13	76113679	missense	probably benign
R3951:Ttc37	UTSW	13	76130219	missense	probably damaging	1.00
R4405:Ttc37	UTSW	13	76155665	missense	probably damaging	0.97
R4411:Ttc37	UTSW	13	76127504	missense	possibly damaging	0.89
R4957:Ttc37	UTSW	13	76185113	splice site	probably null
R4960:Ttc37	UTSW	13	76185156	missense	possibly damaging	0.95
R4993:Ttc37	UTSW	13	76182936	missense	probably damaging	0.96
R5206:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5208:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5302:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5305:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5306:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5579:Ttc37	UTSW	13	76185200	missense	probably damaging	1.00
R5618:Ttc37	UTSW	13	76173426	missense	probably benign
R5726:Ttc37	UTSW	13	76118347	missense	probably damaging	1.00
R5813:Ttc37	UTSW	13	76155733	missense	probably benign	0.05
R5899:Ttc37	UTSW	13	76111819	splice site	probably null
R6146:Ttc37	UTSW	13	76185240	missense	probably damaging	1.00
R6224:Ttc37	UTSW	13	76118291	missense	probably benign	0.02
R6286:Ttc37	UTSW	13	76143240	missense	probably damaging	1.00
R6402:Ttc37	UTSW	13	76135270	missense	probably benign	0.05
R6561:Ttc37	UTSW	13	76150519	missense	probably damaging	1.00
R6808:Ttc37	UTSW	13	76185179	missense	probably damaging	0.96
R7054:Ttc37	UTSW	13	76134960	missense	probably damaging	1.00
R7261:Ttc37	UTSW	13	76113579	missense	probably benign	0.30
R7267:Ttc37	UTSW	13	76180077	missense	probably benign	0.15
R7348:Ttc37	UTSW	13	76182884	missense	possibly damaging	0.82
R7384:Ttc37	UTSW	13	76150735	missense	possibly damaging	0.53
R7404:Ttc37	UTSW	13	76148747	nonsense	probably null
R7421:Ttc37	UTSW	13	76148825	missense	probably benign	0.12
R7546:Ttc37	UTSW	13	76134835	missense	probably damaging	1.00
R7771:Ttc37	UTSW	13	76135030	missense	probably benign	0.21
R7960:Ttc37	UTSW	13	76112199	missense	probably benign	0.03
R8125:Ttc37	UTSW	13	76130327	critical splice donor site	probably null
R8680:Ttc37	UTSW	13	76155468	missense	probably benign	0.01
R8697:Ttc37	UTSW	13	76180155	missense	probably damaging	1.00
R8867:Ttc37	UTSW	13	76131309	missense	probably damaging	0.99
R8872:Ttc37	UTSW	13	76185207	missense	probably damaging	1.00
R8876:Ttc37	UTSW	13	76175284	missense	probably benign	0.12
R9174:Ttc37	UTSW	13	76147774	missense	probably benign	0.00
R9334:Ttc37	UTSW	13	76132957	missense	possibly damaging	0.65
R9389:Ttc37	UTSW	13	76127039	missense	probably benign	0.02
X0067:Ttc37	UTSW	13	76132933	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CATTTCTTCCAGAAGTTTGTCACAG -3'
(R):5'- AAGCTCCACAAGTACACTTCTTAG -3'

Sequencing Primer
(F):5'- ATTGACAGATGATCTTTAGGCTTG -3'
(R):5'- CACTTCTTAGGAAACTTAAGCTAGTG -3'

Posted On

2020-06-30