Incidental Mutation 'R8136:Phf11a'
ID 632273
Institutional Source Beutler Lab
Gene Symbol Phf11a
Ensembl Gene ENSMUSG00000044703
Gene Name PHD finger protein 11A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59276913-59297522 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59277569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 221 (V221A)
Ref Sequence ENSEMBL: ENSMUSP00000053146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062307]
AlphaFold Q8BVM9
Predicted Effect probably benign
Transcript: ENSMUST00000062307
AA Change: V221A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053146
Gene: ENSMUSG00000044703
AA Change: V221A

DomainStartEndE-ValueType
Pfam:zf-HC5HC2H_2 26 142 7.3e-9 PFAM
Pfam:zf-HC5HC2H 51 143 5.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Phf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Phf11a APN 14 59287501 missense probably damaging 0.99
IGL01988:Phf11a APN 14 59277358 missense probably damaging 0.96
IGL02614:Phf11a APN 14 59279368 missense possibly damaging 0.80
R1118:Phf11a UTSW 14 59284329 missense probably benign 0.00
R1623:Phf11a UTSW 14 59287551 missense possibly damaging 0.91
R1661:Phf11a UTSW 14 59280788 missense probably damaging 1.00
R1928:Phf11a UTSW 14 59281867 splice site probably benign
R2022:Phf11a UTSW 14 59294914 missense possibly damaging 0.77
R4836:Phf11a UTSW 14 59287579 missense probably damaging 0.99
R4983:Phf11a UTSW 14 59284438 missense probably benign 0.05
R5074:Phf11a UTSW 14 59284400 missense possibly damaging 0.94
R5411:Phf11a UTSW 14 59294938 missense probably benign
R5510:Phf11a UTSW 14 59279385 missense probably damaging 1.00
R5512:Phf11a UTSW 14 59287550 missense probably benign 0.12
R6209:Phf11a UTSW 14 59287579 missense probably damaging 1.00
R6337:Phf11a UTSW 14 59284368 missense probably damaging 0.99
R6505:Phf11a UTSW 14 59277537 missense probably damaging 0.98
R7368:Phf11a UTSW 14 59280725 missense probably benign 0.01
R8133:Phf11a UTSW 14 59284324 missense probably damaging 1.00
Z1177:Phf11a UTSW 14 59284342 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTGCTTGCACTTCAGGAGAC -3'
(R):5'- TCCCTAGAACAAGAGATGTGC -3'

Sequencing Primer
(F):5'- AGACTCCTGGCATCTGACCTG -3'
(R):5'- CTCTTGAAAGAGTTGTCACTGGGAG -3'
Posted On 2020-06-30