Incidental Mutation 'R8136:Emc2'
ID632274
Institutional Source Beutler Lab
Gene Symbol Emc2
Ensembl Gene ENSMUSG00000022337
Gene NameER membrane protein complex subunit 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R8136 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location43477229-43527763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43511806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 233 (Y233C)
Ref Sequence ENSEMBL: ENSMUSP00000022962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022962]
Predicted Effect probably benign
Transcript: ENSMUST00000022962
AA Change: Y233C

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022962
Gene: ENSMUSG00000022337
AA Change: Y233C

DomainStartEndE-ValueType
coiled coil region 13 36 N/A INTRINSIC
Pfam:TPR_2 88 120 6.8e-5 PFAM
Pfam:TPR_19 98 151 5.9e-8 PFAM
Pfam:TPR_19 131 198 3.7e-8 PFAM
Pfam:TPR_2 155 188 2.4e-6 PFAM
Pfam:TPR_8 155 188 1.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Emc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Emc2 APN 15 43511749 missense probably damaging 1.00
IGL02815:Emc2 APN 15 43507930 splice site probably benign
IGL03211:Emc2 APN 15 43507672 nonsense probably null
IGL03238:Emc2 APN 15 43507853 splice site probably null
R0433:Emc2 UTSW 15 43497124 splice site probably null
R1965:Emc2 UTSW 15 43527467 missense probably damaging 1.00
R2373:Emc2 UTSW 15 43513758 missense probably damaging 1.00
R2507:Emc2 UTSW 15 43511698 critical splice acceptor site probably null
R4986:Emc2 UTSW 15 43511784 missense probably benign 0.29
R5212:Emc2 UTSW 15 43510844 missense probably damaging 1.00
R5368:Emc2 UTSW 15 43511811 critical splice donor site probably null
R5751:Emc2 UTSW 15 43497057 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTCATCAAGAGCTAGGGTGTG -3'
(R):5'- TGTCAAACGGCAAGAATGTAC -3'

Sequencing Primer
(F):5'- CATCAAGAGCTAGGGTGTGTTTTAC -3'
(R):5'- ACGGCAAGAATGTACTAAAATTCAC -3'
Posted On2020-06-30