Incidental Mutation 'R8136:Slc22a2'
ID 632275
Institutional Source Beutler Lab
Gene Symbol Slc22a2
Ensembl Gene ENSMUSG00000040966
Gene Name solute carrier family 22 (organic cation transporter), member 2
Synonyms Orct2, Oct2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 214.009
Status Validated
Chromosome 17
Chromosomal Location 12584189-12628465 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12606030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 260 (P260S)
Ref Sequence ENSEMBL: ENSMUSP00000041186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046959]
AlphaFold O70577
Predicted Effect probably damaging
Transcript: ENSMUST00000046959
AA Change: P260S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: P260S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 80 528 7.6e-37 PFAM
Pfam:MFS_1 134 398 3.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Slc22a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc22a2 APN 17 12608418 missense possibly damaging 0.79
IGL00658:Slc22a2 APN 17 12615315 missense probably benign 0.37
IGL01073:Slc22a2 APN 17 12584349 missense probably benign 0.00
IGL01573:Slc22a2 APN 17 12605961 missense probably damaging 0.99
IGL02000:Slc22a2 APN 17 12584383 missense possibly damaging 0.77
IGL02943:Slc22a2 APN 17 12610061 missense probably damaging 1.00
IGL03301:Slc22a2 APN 17 12606039 missense probably damaging 1.00
R0492:Slc22a2 UTSW 17 12615272 missense probably benign 0.00
R0835:Slc22a2 UTSW 17 12612431 missense probably benign 0.01
R1330:Slc22a2 UTSW 17 12586812 missense possibly damaging 0.94
R1432:Slc22a2 UTSW 17 12584308 missense possibly damaging 0.89
R1559:Slc22a2 UTSW 17 12584411 missense probably damaging 1.00
R1855:Slc22a2 UTSW 17 12586812 missense probably damaging 0.99
R1884:Slc22a2 UTSW 17 12614826 splice site probably benign
R2042:Slc22a2 UTSW 17 12599125 missense probably benign 0.01
R2197:Slc22a2 UTSW 17 12599062 missense probably damaging 1.00
R2255:Slc22a2 UTSW 17 12599175 missense probably damaging 1.00
R2271:Slc22a2 UTSW 17 12586805 missense probably benign
R4003:Slc22a2 UTSW 17 12612450 missense probably benign 0.01
R4021:Slc22a2 UTSW 17 12584489 missense probably damaging 1.00
R4093:Slc22a2 UTSW 17 12612394 missense probably damaging 1.00
R4404:Slc22a2 UTSW 17 12614764 missense probably damaging 1.00
R4419:Slc22a2 UTSW 17 12612586 nonsense probably null
R4564:Slc22a2 UTSW 17 12610056 missense probably benign 0.08
R4866:Slc22a2 UTSW 17 12584429 missense probably damaging 1.00
R4877:Slc22a2 UTSW 17 12614815 missense possibly damaging 0.53
R5224:Slc22a2 UTSW 17 12586832 missense probably damaging 0.97
R5668:Slc22a2 UTSW 17 12608409 missense probably benign
R6326:Slc22a2 UTSW 17 12612410 nonsense probably null
R7137:Slc22a2 UTSW 17 12584341 missense probably benign
R7211:Slc22a2 UTSW 17 12586883 critical splice donor site probably null
R7378:Slc22a2 UTSW 17 12612391 missense probably damaging 1.00
R7521:Slc22a2 UTSW 17 12586823 missense probably benign 0.14
R7524:Slc22a2 UTSW 17 12606057 missense possibly damaging 0.87
R7735:Slc22a2 UTSW 17 12610030 missense probably damaging 0.99
R8671:Slc22a2 UTSW 17 12605976 nonsense probably null
R8799:Slc22a2 UTSW 17 12612538 missense probably benign 0.14
R8874:Slc22a2 UTSW 17 12609979 missense probably benign 0.37
R9046:Slc22a2 UTSW 17 12615347 missense probably null 0.15
R9220:Slc22a2 UTSW 17 12619870 missense probably benign 0.03
R9367:Slc22a2 UTSW 17 12605950 missense probably benign 0.19
R9410:Slc22a2 UTSW 17 12586845
Z1088:Slc22a2 UTSW 17 12614776 missense probably benign 0.36
Z1176:Slc22a2 UTSW 17 12584625 missense possibly damaging 0.79
Z1177:Slc22a2 UTSW 17 12606010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATAAGGTTGGGAGTCA -3'
(R):5'- GGTCACAAAAGTCTTAGGCCCA -3'

Sequencing Primer
(F):5'- AGTCAGTTTTGGCTCATCCTG -3'
(R):5'- TGGATTTCCAGCAGGGGAC -3'
Posted On 2020-06-30