Incidental Mutation 'R8136:Treml4'
ID 632276
Institutional Source Beutler Lab
Gene Symbol Treml4
Ensembl Gene ENSMUSG00000051682
Gene Name triggering receptor expressed on myeloid cells-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 48264295-48275360 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 48264717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 49 (Y49*)
Ref Sequence ENSEMBL: ENSMUSP00000118772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059873] [ENSMUST00000125426] [ENSMUST00000136272] [ENSMUST00000153420] [ENSMUST00000154335]
AlphaFold Q3LRV9
Predicted Effect probably null
Transcript: ENSMUST00000059873
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000054121
Gene: ENSMUSG00000051682
AA Change: Y49*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
IG 32 137 6.51e-3 SMART
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125426
AA Change: Y45*
SMART Domains Protein: ENSMUSP00000119177
Gene: ENSMUSG00000051682
AA Change: Y45*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
IG 28 133 6.51e-3 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136272
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000120550
Gene: ENSMUSG00000051682
AA Change: Y49*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
IG 32 137 6.51e-3 SMART
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153420
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000115290
Gene: ENSMUSG00000051682
AA Change: Y49*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
IG 32 137 6.51e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154335
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000118772
Gene: ENSMUSG00000051682
AA Change: Y49*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 32 137 6.51e-3 SMART
transmembrane domain 201 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele do not exhibit any significant alterations in the uptake and cross-presentation of dying cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Treml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Treml4 APN 17 48264849 missense possibly damaging 0.82
IGL01451:Treml4 APN 17 48264995 splice site probably benign
IGL01787:Treml4 APN 17 48264704 missense probably damaging 1.00
R0027:Treml4 UTSW 17 48264934 missense possibly damaging 0.82
R1975:Treml4 UTSW 17 48272793 missense probably damaging 1.00
R4013:Treml4 UTSW 17 48264809 missense probably benign 0.09
R4327:Treml4 UTSW 17 48274389 missense probably damaging 0.98
R5586:Treml4 UTSW 17 48264899 missense probably damaging 1.00
R6220:Treml4 UTSW 17 48264848 missense possibly damaging 0.91
R6510:Treml4 UTSW 17 48274444 missense probably benign
R6964:Treml4 UTSW 17 48272819 critical splice donor site probably null
R8289:Treml4 UTSW 17 48274428 missense probably benign 0.23
R9070:Treml4 UTSW 17 48269753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTGGAAGTCATTGCCTC -3'
(R):5'- ACAGTTACTTCTCTGAGGGAAGG -3'

Sequencing Primer
(F):5'- ACCTCTGACCTGACAGTT -3'
(R):5'- AGTAGAACGCTGAGTCATCCTCTG -3'
Posted On 2020-06-30