Incidental Mutation 'R8137:Slco4c1'
ID632281
Institutional Source Beutler Lab
Gene Symbol Slco4c1
Ensembl Gene ENSMUSG00000040693
Gene Namesolute carrier organic anion transporter family, member 4C1
SynonymsOATP-H, OATP4C1, PRO2176, OATP-M1, SLC21A20, C330017E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location96816270-96872171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96821245 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 649 (G649E)
Ref Sequence ENSEMBL: ENSMUSP00000071875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071985]
Predicted Effect probably damaging
Transcript: ENSMUST00000071985
AA Change: G649E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071875
Gene: ENSMUSG00000040693
AA Change: G649E

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
Pfam:MFS_1 102 483 1.3e-19 PFAM
KAZAL 503 547 1.67e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Slco4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Slco4c1 APN 1 96841187 missense probably damaging 0.99
IGL01510:Slco4c1 APN 1 96867953 missense probably damaging 1.00
IGL01674:Slco4c1 APN 1 96842493 missense probably damaging 1.00
IGL02444:Slco4c1 APN 1 96844509 missense probably damaging 1.00
IGL03355:Slco4c1 APN 1 96842507 nonsense probably null
H8562:Slco4c1 UTSW 1 96842485 missense probably benign 0.01
H8786:Slco4c1 UTSW 1 96841151 missense probably damaging 1.00
R0350:Slco4c1 UTSW 1 96828849 missense probably benign 0.18
R0463:Slco4c1 UTSW 1 96867920 missense possibly damaging 0.93
R0550:Slco4c1 UTSW 1 96867859 missense probably damaging 1.00
R1122:Slco4c1 UTSW 1 96828836 missense possibly damaging 0.89
R1205:Slco4c1 UTSW 1 96867888 missense probably damaging 1.00
R1215:Slco4c1 UTSW 1 96828871 missense probably damaging 1.00
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1907:Slco4c1 UTSW 1 96842499 missense probably damaging 1.00
R1960:Slco4c1 UTSW 1 96867929 missense probably benign 0.00
R2372:Slco4c1 UTSW 1 96821200 missense probably benign 0.00
R3424:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R3425:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R4292:Slco4c1 UTSW 1 96844656 critical splice acceptor site probably null
R4656:Slco4c1 UTSW 1 96841245 missense probably benign 0.01
R4852:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4854:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4865:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4867:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4898:Slco4c1 UTSW 1 96837512 missense probably damaging 1.00
R4900:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5023:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5074:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5348:Slco4c1 UTSW 1 96842529 missense probably damaging 0.99
R5356:Slco4c1 UTSW 1 96832110 missense probably damaging 1.00
R5471:Slco4c1 UTSW 1 96872045 missense probably benign 0.34
R5683:Slco4c1 UTSW 1 96867834 missense probably damaging 1.00
R5797:Slco4c1 UTSW 1 96819104 missense probably benign 0.04
R5801:Slco4c1 UTSW 1 96872084 missense probably damaging 0.96
R5837:Slco4c1 UTSW 1 96818982 missense probably benign 0.40
R6242:Slco4c1 UTSW 1 96839283 missense probably damaging 0.99
R7014:Slco4c1 UTSW 1 96823781 splice site probably null
R7112:Slco4c1 UTSW 1 96841141 missense probably damaging 1.00
R7174:Slco4c1 UTSW 1 96837598 missense possibly damaging 0.87
R7265:Slco4c1 UTSW 1 96871793 missense probably damaging 0.99
R7275:Slco4c1 UTSW 1 96871772 missense probably benign 0.38
R7305:Slco4c1 UTSW 1 96828965 missense probably damaging 1.00
R7428:Slco4c1 UTSW 1 96837520 missense possibly damaging 0.68
R7649:Slco4c1 UTSW 1 96828942 missense probably benign 0.03
R7980:Slco4c1 UTSW 1 96836925 missense probably benign 0.20
R8188:Slco4c1 UTSW 1 96844536 missense probably damaging 1.00
Z1176:Slco4c1 UTSW 1 96821230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTGAAATCATGTTGGG -3'
(R):5'- CGCGTTGACTTAGATGTGAATTAG -3'

Sequencing Primer
(F):5'- CCTCTGAAATCATGTTGGGTAGATTC -3'
(R):5'- AGATGTGAATTAGCTAATGTATGTGG -3'
Posted On2020-06-30