Incidental Mutation 'R8137:Zfp648'
ID632282
Institutional Source Beutler Lab
Gene Symbol Zfp648
Ensembl Gene ENSMUSG00000066797
Gene Namezinc finger protein 648
SynonymsLOC207678, Gm10178
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8137 (G1)
Quality Score155.008
Status Validated
Chromosome1
Chromosomal Location154201187-154205689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154205364 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 423 (H423R)
Ref Sequence ENSEMBL: ENSMUSP00000083370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086195]
Predicted Effect probably damaging
Transcript: ENSMUST00000086195
AA Change: H423R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083370
Gene: ENSMUSG00000066797
AA Change: H423R

DomainStartEndE-ValueType
ZnF_C2H2 236 258 1.82e-3 SMART
ZnF_C2H2 264 286 1.28e-3 SMART
ZnF_C2H2 292 315 1.2e-3 SMART
ZnF_C2H2 321 343 1.95e-3 SMART
ZnF_C2H2 349 371 8.94e-3 SMART
ZnF_C2H2 377 399 8.34e-3 SMART
ZnF_C2H2 405 427 4.54e-4 SMART
ZnF_C2H2 433 455 4.47e-3 SMART
ZnF_C2H2 461 483 5.81e-2 SMART
ZnF_C2H2 489 511 1.2e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Zfp648
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp648 APN 1 154204189 missense possibly damaging 0.88
IGL01150:Zfp648 APN 1 154205364 missense probably damaging 1.00
IGL01557:Zfp648 APN 1 154204680 missense probably benign
IGL01757:Zfp648 APN 1 154204925 missense probably damaging 0.98
IGL02247:Zfp648 APN 1 154204177 missense probably benign 0.01
PIT4519001:Zfp648 UTSW 1 154204941 missense probably damaging 0.98
R0001:Zfp648 UTSW 1 154205286 missense probably damaging 1.00
R0256:Zfp648 UTSW 1 154205668 missense probably benign 0.08
R0266:Zfp648 UTSW 1 154204886 missense probably damaging 1.00
R0371:Zfp648 UTSW 1 154204667 missense possibly damaging 0.66
R1498:Zfp648 UTSW 1 154205373 missense probably damaging 1.00
R1562:Zfp648 UTSW 1 154204392 missense probably benign
R1687:Zfp648 UTSW 1 154204242 missense probably benign 0.15
R2128:Zfp648 UTSW 1 154204607 missense probably benign
R2427:Zfp648 UTSW 1 154205073 missense probably damaging 1.00
R2567:Zfp648 UTSW 1 154204949 missense probably damaging 0.98
R2844:Zfp648 UTSW 1 154205135 nonsense probably null
R3711:Zfp648 UTSW 1 154204558 missense probably benign 0.30
R4491:Zfp648 UTSW 1 154205127 missense probably damaging 1.00
R4693:Zfp648 UTSW 1 154204406 missense probably benign 0.01
R5666:Zfp648 UTSW 1 154204217 missense probably benign 0.00
R5670:Zfp648 UTSW 1 154204217 missense probably benign 0.00
R7432:Zfp648 UTSW 1 154205037 missense possibly damaging 0.84
R8069:Zfp648 UTSW 1 154204116 missense probably benign 0.34
R8282:Zfp648 UTSW 1 154204789 missense probably benign 0.25
Z1088:Zfp648 UTSW 1 154204520 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGCGGCTTGACCTTCAAC -3'
(R):5'- CCATTGTGCATGCGGATGTG -3'

Sequencing Primer
(F):5'- AGGCCACTGTCACTGCTG -3'
(R):5'- ATGTGCTGCGCCAACTC -3'
Posted On2020-06-30