Incidental Mutation 'R8137:Foxa2'
ID632290
Institutional Source Beutler Lab
Gene Symbol Foxa2
Ensembl Gene ENSMUSG00000037025
Gene Nameforkhead box A2
SynonymsHnf-3b, Hnf3b, Tcf-3b, HNF3-beta, Tcf3b, HNF3beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148042877-148046969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148043848 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 355 (H355R)
Ref Sequence ENSEMBL: ENSMUSP00000105590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047315] [ENSMUST00000109964] [ENSMUST00000172928]
Predicted Effect probably benign
Transcript: ENSMUST00000047315
AA Change: H349R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045918
Gene: ENSMUSG00000037025
AA Change: H349R

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 44 67 N/A INTRINSIC
low complexity region 74 104 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
FH 157 247 4.77e-62 SMART
low complexity region 262 281 N/A INTRINSIC
low complexity region 326 365 N/A INTRINSIC
Pfam:HNF_C 374 448 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109964
AA Change: H355R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105590
Gene: ENSMUSG00000037025
AA Change: H355R

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 50 73 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
FH 163 253 4.77e-62 SMART
low complexity region 268 287 N/A INTRINSIC
low complexity region 332 371 N/A INTRINSIC
Pfam:HNF_C 380 454 5.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172928
AA Change: H174R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134081
Gene: ENSMUSG00000037025
AA Change: H174R

DomainStartEndE-ValueType
FH 13 72 1.94e-12 SMART
low complexity region 87 106 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
Pfam:HNF_C 199 273 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Embryos homozygous for targeted null mutations fail to form a distinct node, lack a notochord, and die by embryonic day 10 or 11. Mutants also exhibit defects of somite and neural tube organization, and lack a floor plate and motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Foxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Foxa2 APN 2 148044818 missense possibly damaging 0.93
IGL02560:Foxa2 APN 2 148044031 missense probably benign 0.40
IGL02797:Foxa2 APN 2 148044125 missense possibly damaging 0.95
R6768_Foxa2_027 UTSW 2 148043827 missense probably damaging 0.97
R0116:Foxa2 UTSW 2 148043561 missense probably damaging 0.99
R2252:Foxa2 UTSW 2 148044166 missense probably damaging 0.98
R4334:Foxa2 UTSW 2 148044703 missense possibly damaging 0.85
R5293:Foxa2 UTSW 2 148044002 missense probably benign 0.09
R5339:Foxa2 UTSW 2 148044434 missense probably damaging 1.00
R6768:Foxa2 UTSW 2 148043827 missense probably damaging 0.97
R8036:Foxa2 UTSW 2 148043989 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGTTCGTAGGCCTTGAG -3'
(R):5'- AACTGGCACTGAAGGAAGCC -3'

Sequencing Primer
(F):5'- AGGCCTTGAGGTCCATTTTG -3'
(R):5'- AAGAAGACCGCTCCTGGGTC -3'
Posted On2020-06-30