Incidental Mutation 'R8137:Cyp7b1'
ID632291
Institutional Source Beutler Lab
Gene Symbol Cyp7b1
Ensembl Gene ENSMUSG00000039519
Gene Namecytochrome P450, family 7, subfamily b, polypeptide 1
SynonymsD3Ertd552e, hct-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location18071950-18243338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18097601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 149 (D149E)
Ref Sequence ENSEMBL: ENSMUSP00000037487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035625]
Predicted Effect probably benign
Transcript: ENSMUST00000035625
AA Change: D149E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: D149E

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:p450 44 496 1e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Cyp7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Cyp7b1 APN 3 18072575 missense probably damaging 1.00
R0166:Cyp7b1 UTSW 3 18097366 missense probably benign 0.23
R0334:Cyp7b1 UTSW 3 18103796 missense probably damaging 1.00
R0417:Cyp7b1 UTSW 3 18096691 missense probably damaging 1.00
R0696:Cyp7b1 UTSW 3 18072585 missense probably benign 0.23
R0894:Cyp7b1 UTSW 3 18097510 missense probably benign 0.00
R1799:Cyp7b1 UTSW 3 18097452 missense probably benign 0.01
R1893:Cyp7b1 UTSW 3 18096567 missense possibly damaging 0.57
R4538:Cyp7b1 UTSW 3 18097581 missense possibly damaging 0.71
R4692:Cyp7b1 UTSW 3 18072564 missense probably damaging 0.97
R4877:Cyp7b1 UTSW 3 18097293 missense probably damaging 0.98
R5382:Cyp7b1 UTSW 3 18097221 missense possibly damaging 0.53
R5841:Cyp7b1 UTSW 3 18097506 missense probably damaging 1.00
R6867:Cyp7b1 UTSW 3 18097230 missense probably damaging 1.00
R7007:Cyp7b1 UTSW 3 18097618 nonsense probably null
R7379:Cyp7b1 UTSW 3 18097374 missense probably benign 0.23
R7554:Cyp7b1 UTSW 3 18097446 missense probably benign 0.00
R7814:Cyp7b1 UTSW 3 18097302 missense probably benign 0.00
R8338:Cyp7b1 UTSW 3 18097566 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTATGTCAGATACTAAGTATGGGAAC -3'
(R):5'- TGAACCCTTTCCAGTACCAGTATG -3'

Sequencing Primer
(F):5'- CATCCCTTAGCTCACTGATAATTTG -3'
(R):5'- ACCCTTTCCAGTACCAGTATGTAACG -3'
Posted On2020-06-30