Incidental Mutation 'R8137:Il27ra'
ID632305
Institutional Source Beutler Lab
Gene Symbol Il27ra
Ensembl Gene ENSMUSG00000005465
Gene Nameinterleukin 27 receptor, alpha
SynonymsIL-27R, WSX-1, Tccr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84030294-84042589 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 84041091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000005601] [ENSMUST00000005601] [ENSMUST00000061923]
Predicted Effect probably null
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061923
SMART Domains Protein: ENSMUSP00000051392
Gene: ENSMUSG00000045232

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 31 140 5.7e-7 SMART
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: T helper 1 response and responses to parasitic and bacterial infection are altered in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Il27ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Il27ra APN 8 84031535 missense probably benign 0.01
IGL03096:Il27ra APN 8 84031532 missense probably damaging 1.00
IGL03334:Il27ra APN 8 84031122 missense probably benign 0.08
angel UTSW 8 84032144 critical splice acceptor site probably null
Gabriel UTSW 8 84033985 missense probably damaging 0.97
herald UTSW 8 84033949 critical splice donor site probably null
R0133:Il27ra UTSW 8 84033942 unclassified probably benign
R0526:Il27ra UTSW 8 84039499 missense probably benign 0.37
R2914:Il27ra UTSW 8 84031613 unclassified probably benign
R3001:Il27ra UTSW 8 84032031 nonsense probably null
R3002:Il27ra UTSW 8 84032031 nonsense probably null
R3003:Il27ra UTSW 8 84032031 nonsense probably null
R3851:Il27ra UTSW 8 84040688 missense probably benign 0.00
R3978:Il27ra UTSW 8 84040684 missense probably benign 0.11
R4589:Il27ra UTSW 8 84036409 missense probably damaging 1.00
R4997:Il27ra UTSW 8 84039527 nonsense probably null
R5133:Il27ra UTSW 8 84034059 missense possibly damaging 0.71
R5955:Il27ra UTSW 8 84040822 missense probably benign 0.05
R6153:Il27ra UTSW 8 84032144 critical splice acceptor site probably null
R6489:Il27ra UTSW 8 84031550 missense probably benign 0.02
R7465:Il27ra UTSW 8 84039612 missense probably benign 0.00
R7828:Il27ra UTSW 8 84031558 missense probably damaging 1.00
R7890:Il27ra UTSW 8 84033985 missense probably damaging 0.97
R8051:Il27ra UTSW 8 84033949 critical splice donor site probably null
R8335:Il27ra UTSW 8 84039501 missense probably damaging 0.96
X0013:Il27ra UTSW 8 84042159 missense probably benign 0.21
Z1176:Il27ra UTSW 8 84040990 missense probably damaging 1.00
Z1177:Il27ra UTSW 8 84040975 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCACGCTTCATTACTTTGGG -3'
(R):5'- TGTAAACTGTCAGTCACCCGG -3'

Sequencing Primer
(F):5'- GTCTCCAGGTTCACAGAGACAG -3'
(R):5'- GCCCACTGTTGAGTTCTTTCAGAAAG -3'
Posted On2020-06-30