Incidental Mutation 'R8137:Pygo1'
ID632308
Institutional Source Beutler Lab
Gene Symbol Pygo1
Ensembl Gene ENSMUSG00000034910
Gene Namepygopus 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location72925645-72952181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72944858 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 109 (H109R)
Ref Sequence ENSEMBL: ENSMUSP00000044368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038489]
PDB Structure
Crystal Structure Analysis of the PHD domain of the Transcription Coactivator Pygophus [X-RAY DIFFRACTION]
Structural analysis of PHD domain of Pygopus complexed with trimethylated histone H3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000038489
AA Change: H109R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044368
Gene: ENSMUSG00000034910
AA Change: H109R

DomainStartEndE-ValueType
low complexity region 17 27 N/A INTRINSIC
Blast:HECTc 28 125 6e-28 BLAST
PHD 340 394 5.57e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and show no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Pygo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Pygo1 APN 9 72945288 missense probably damaging 1.00
IGL02033:Pygo1 APN 9 72945401 missense possibly damaging 0.59
IGL02445:Pygo1 APN 9 72925940 missense probably benign 0.12
IGL02751:Pygo1 APN 9 72945037 missense probably benign 0.09
IGL02938:Pygo1 APN 9 72944738 missense probably damaging 1.00
R1809:Pygo1 UTSW 9 72944796 missense probably damaging 1.00
R2190:Pygo1 UTSW 9 72945247 nonsense probably null
R5037:Pygo1 UTSW 9 72944917 missense probably damaging 0.98
R5523:Pygo1 UTSW 9 72944984 missense possibly damaging 0.68
R5539:Pygo1 UTSW 9 72944779 missense probably damaging 1.00
R6163:Pygo1 UTSW 9 72944698 missense probably damaging 1.00
R6340:Pygo1 UTSW 9 72945429 missense probably damaging 1.00
R6803:Pygo1 UTSW 9 72942985 missense probably damaging 1.00
R7716:Pygo1 UTSW 9 72942926 missense probably damaging 1.00
R8419:Pygo1 UTSW 9 72945098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTATTCTCCTTGCAGGGATC -3'
(R):5'- GCTGACCGGGCATGTTAATG -3'

Sequencing Primer
(F):5'- TTTCCTCCGCTGTCAGAGTACG -3'
(R):5'- GCATGTTAATGTCCTGAGTCAGTAC -3'
Posted On2020-06-30