Incidental Mutation 'R8137:Tjp3'
ID632311
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Nametight junction protein 3
SynonymsZO-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8137 (G1)
Quality Score211.009
Status Validated
Chromosome10
Chromosomal Location81273207-81291581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81273691 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 857 (D857G)
Ref Sequence ENSEMBL: ENSMUSP00000036438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
AA Change: D857G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: D857G

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Predicted Effect probably benign
Transcript: ENSMUST00000219479
AA Change: D857G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81273865 missense probably benign
IGL01739:Tjp3 APN 10 81278656 missense probably benign 0.09
IGL02826:Tjp3 APN 10 81273689 missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81283688 missense probably benign 0.05
PIT4480001:Tjp3 UTSW 10 81279257 missense probably damaging 1.00
R0561:Tjp3 UTSW 10 81273840 missense probably benign
R0562:Tjp3 UTSW 10 81280555 missense probably damaging 0.99
R1099:Tjp3 UTSW 10 81273823 missense probably benign
R1618:Tjp3 UTSW 10 81276260 unclassified probably benign
R1786:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R1955:Tjp3 UTSW 10 81277999 missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81280544 missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2178:Tjp3 UTSW 10 81280107 missense probably benign 0.17
R3054:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R3055:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R5470:Tjp3 UTSW 10 81279547 missense probably benign 0.04
R5645:Tjp3 UTSW 10 81278620 splice site probably null
R5918:Tjp3 UTSW 10 81277912 missense probably benign 0.01
R6108:Tjp3 UTSW 10 81281146 missense probably benign
R6245:Tjp3 UTSW 10 81277276 missense probably benign 0.02
R6300:Tjp3 UTSW 10 81281117 nonsense probably null
R7686:Tjp3 UTSW 10 81278051 missense probably benign 0.00
R7958:Tjp3 UTSW 10 81282994 missense possibly damaging 0.56
R8240:Tjp3 UTSW 10 81273807 missense probably benign 0.06
R8317:Tjp3 UTSW 10 81280490 missense probably benign 0.11
Z1176:Tjp3 UTSW 10 81281109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTTGGGACTTGAAACTC -3'
(R):5'- AACAGCGACTATGAGGACAC -3'

Sequencing Primer
(F):5'- GTTGGGACTTGAAACTCCTTCATATC -3'
(R):5'- CCGTATGGGTAGATGATCACC -3'
Posted On2020-06-30