Incidental Mutation 'R8137:Vezt'
ID632312
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Namevezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8137 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93939165-94035817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93939292 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 94 (N94D)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000121105
Gene: ENSMUSG00000036099
AA Change: N94D

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1633:Vezt UTSW 10 93984276 missense probably damaging 1.00
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4296:Vezt UTSW 10 93973931 small deletion probably benign
R4972:Vezt UTSW 10 94000350 critical splice donor site probably null
R5079:Vezt UTSW 10 94020624 splice site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6652:Vezt UTSW 10 93970279 missense probably damaging 1.00
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
R7100:Vezt UTSW 10 93996933 missense probably benign 0.13
R7131:Vezt UTSW 10 93970547 nonsense probably null
R7743:Vezt UTSW 10 93980424 missense probably damaging 1.00
R8393:Vezt UTSW 10 93996842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGCCTACTAATCGTTTGAG -3'
(R):5'- CTCATACCCGCAGCTTCAAG -3'

Sequencing Primer
(F):5'- ACTAACACGCTGTCAGCT -3'
(R):5'- TCAATGGATCTCTTCAAAAACCTTC -3'
Posted On2020-06-30