Incidental Mutation 'R8137:Gspt1'
ID632323
Institutional Source Beutler Lab
Gene Symbol Gspt1
Ensembl Gene ENSMUSG00000062203
Gene NameG1 to S phase transition 1
SynonymsGst-1, G1st, Gst-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R8137 (G1)
Quality Score165.009
Status Validated
Chromosome16
Chromosomal Location11219292-11254325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11240668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000078940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080030] [ENSMUST00000167571]
PDB Structure
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000080030
AA Change: V144A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078940
Gene: ENSMUSG00000062203
AA Change: V144A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 4.3e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 151 193 N/A INTRINSIC
Pfam:GTP_EFTU 209 482 3.1e-47 PFAM
Pfam:GTP_EFTU_D2 451 518 1.2e-8 PFAM
Pfam:GTP_EFTU_D3 524 632 7.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167571
AA Change: V144A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130583
Gene: ENSMUSG00000062203
AA Change: V144A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 7.1e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Pfam:GTP_EFTU 208 476 4.3e-49 PFAM
Pfam:GTP_EFTU_D2 450 517 1.3e-7 PFAM
Pfam:GTP_EFTU_D3 523 631 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tctn3 A T 19: 40,605,341 W462R probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Gspt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Gspt1 APN 16 11222612 missense probably damaging 0.99
IGL00902:Gspt1 APN 16 11232579 missense probably damaging 1.00
IGL00983:Gspt1 APN 16 11230997 splice site probably benign
IGL01775:Gspt1 APN 16 11223295 missense possibly damaging 0.92
IGL02079:Gspt1 APN 16 11240829 missense probably benign 0.17
IGL02122:Gspt1 APN 16 11229216 missense probably damaging 1.00
IGL02525:Gspt1 APN 16 11230990 missense probably damaging 1.00
IGL03092:Gspt1 APN 16 11238899 missense probably benign 0.11
goliad UTSW 16 11224542 missense probably benign 0.04
R0835:Gspt1 UTSW 16 11238938 missense probably benign
R1519:Gspt1 UTSW 16 11220855 missense probably damaging 1.00
R3410:Gspt1 UTSW 16 11229245 missense probably damaging 1.00
R4834:Gspt1 UTSW 16 11222717 missense probably damaging 1.00
R4866:Gspt1 UTSW 16 11222665 missense possibly damaging 0.69
R5121:Gspt1 UTSW 16 11223301 missense probably damaging 0.99
R5408:Gspt1 UTSW 16 11253855 missense probably benign
R5410:Gspt1 UTSW 16 11230510 missense probably benign 0.00
R5517:Gspt1 UTSW 16 11253979 missense unknown
R5704:Gspt1 UTSW 16 11228193 missense possibly damaging 0.89
R6224:Gspt1 UTSW 16 11224542 missense probably benign 0.04
R6317:Gspt1 UTSW 16 11223208 splice site probably null
R7069:Gspt1 UTSW 16 11222661 missense probably damaging 1.00
R7151:Gspt1 UTSW 16 11253828 missense probably benign 0.05
R7317:Gspt1 UTSW 16 11222657 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTAAGGCCACGTTAATGCTC -3'
(R):5'- TAAGCAAGGAAGATGCAGCTTC -3'

Sequencing Primer
(F):5'- AGGCCACGTTAATGCTCAATTTGC -3'
(R):5'- GCAAGGAAGATGCAGCTTCATTTC -3'
Posted On2020-06-30