Incidental Mutation 'R8137:Pde10a'
ID 632325
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
MMRRC Submission 067565-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8137 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 8744204-9205480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9193647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 693 (Y693C)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: Y613C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: Y613C

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089085
AA Change: Y693C

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: Y693C

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115708
AA Change: Y409C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: Y409C

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: Y613C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: Y613C

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably damaging
Transcript: ENSMUST00000115720
AA Change: Y676C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: Y676C

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: Y747C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: Y747C

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149440
AA Change: Y624C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: Y624C

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: Y975C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,344,003 (GRCm39) Q326H probably benign Het
Carf G A 1: 60,187,124 (GRCm39) V576I probably benign Het
Ccnl1 C T 3: 65,865,291 (GRCm39) D87N possibly damaging Het
Cgref1 T A 5: 31,091,749 (GRCm39) D111V possibly damaging Het
Cnot4 G A 6: 35,023,222 (GRCm39) P567S unknown Het
Cyp7b1 A T 3: 18,151,765 (GRCm39) D149E probably benign Het
Dcc A T 18: 71,511,783 (GRCm39) D877E probably benign Het
Dhx8 T A 11: 101,654,808 (GRCm39) I1032N probably damaging Het
Dnah7b A G 1: 46,272,913 (GRCm39) Y2347C probably damaging Het
Dtx3 A G 10: 127,029,041 (GRCm39) S63P possibly damaging Het
Dyrk2 C T 10: 118,695,789 (GRCm39) E490K probably benign Het
Fcgbp A C 7: 27,804,496 (GRCm39) Y1868S probably damaging Het
Foxa2 T C 2: 147,885,768 (GRCm39) H355R probably benign Het
Fpr-rs7 A G 17: 20,334,055 (GRCm39) V145A possibly damaging Het
Gm14137 A T 2: 119,005,837 (GRCm39) E132V probably benign Het
Gpn2 T C 4: 133,315,873 (GRCm39) S211P possibly damaging Het
Greb1l A T 18: 10,474,357 (GRCm39) Q224L possibly damaging Het
Gspt1 A G 16: 11,058,532 (GRCm39) V144A probably benign Het
Ifi204 A G 1: 173,589,188 (GRCm39) I81T possibly damaging Het
Il27ra T A 8: 84,767,720 (GRCm39) probably null Het
Kif21a T C 15: 90,852,645 (GRCm39) T862A probably benign Het
Klf2 T C 8: 73,074,088 (GRCm39) probably null Het
Kmt2e A G 5: 23,706,952 (GRCm39) Y1505C probably damaging Het
Mcm9 T C 10: 53,499,076 (GRCm39) T216A Het
Muc16 T C 9: 18,556,972 (GRCm39) E3107G unknown Het
Ncor2 C T 5: 125,114,957 (GRCm39) V169I Het
Oas3 T C 5: 120,915,565 (GRCm39) Q42R probably benign Het
Or2l5 A G 16: 19,333,846 (GRCm39) V180A possibly damaging Het
Or4p8 T C 2: 88,727,013 (GRCm39) *309W probably null Het
Pde11a T C 2: 76,041,383 (GRCm39) E429G possibly damaging Het
Pramel23 A G 4: 143,425,835 (GRCm39) F36S probably damaging Het
Pygo1 A G 9: 72,852,140 (GRCm39) H109R probably damaging Het
Rbsn A T 6: 92,167,003 (GRCm39) V547D probably benign Het
Ros1 A G 10: 52,001,933 (GRCm39) I1084T possibly damaging Het
Sis T C 3: 72,796,378 (GRCm39) D1801G probably benign Het
Slco4c1 C T 1: 96,748,970 (GRCm39) G649E probably damaging Het
Spmip10 A G 18: 56,727,653 (GRCm39) D117G probably damaging Het
Sptbn2 A T 19: 4,787,431 (GRCm39) I914F possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Strc C T 2: 121,197,219 (GRCm39) G1503R probably damaging Het
Sv2c T A 13: 96,225,171 (GRCm39) Y46F probably damaging Het
Tctn3 A T 19: 40,593,785 (GRCm39) W462R probably damaging Het
Tjp3 T C 10: 81,109,525 (GRCm39) D857G probably benign Het
Tor1aip2 C T 1: 155,939,414 (GRCm39) T242I possibly damaging Het
Ttn T A 2: 76,800,273 (GRCm39) I312F unknown Het
Vezt T C 10: 93,775,154 (GRCm39) N94D Het
Vmn2r105 T C 17: 20,454,966 (GRCm39) N57D probably benign Het
Wdr59 T C 8: 112,212,011 (GRCm39) D353G Het
Ykt6 T C 11: 5,909,368 (GRCm39) V59A probably damaging Het
Ypel3 T G 7: 126,377,269 (GRCm39) V54G possibly damaging Het
Zfp386 T A 12: 116,023,268 (GRCm39) C329S possibly damaging Het
Zfp451 A T 1: 33,821,156 (GRCm39) L232H possibly damaging Het
Zfp648 A G 1: 154,081,110 (GRCm39) H423R probably damaging Het
Zfp729b T C 13: 67,740,861 (GRCm39) Y468C probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 9,163,802 (GRCm39) missense probably damaging 1.00
IGL01762:Pde10a APN 17 9,161,750 (GRCm39) missense possibly damaging 0.74
IGL01814:Pde10a APN 17 9,147,939 (GRCm39) start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 9,193,601 (GRCm39) missense probably damaging 1.00
IGL02386:Pde10a APN 17 9,172,636 (GRCm39) missense possibly damaging 0.93
IGL02573:Pde10a APN 17 9,180,722 (GRCm39) missense probably benign 0.38
IGL02583:Pde10a APN 17 9,200,462 (GRCm39) missense probably benign 0.23
IGL02649:Pde10a APN 17 9,172,604 (GRCm39) missense probably damaging 1.00
IGL02992:Pde10a APN 17 9,168,293 (GRCm39) missense probably damaging 0.97
IGL03109:Pde10a APN 17 9,148,046 (GRCm39) critical splice donor site probably null
brautigam UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
Bride UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
buzzed UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
Gracile UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
Nubile UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
thunderball UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R0004:Pde10a UTSW 17 9,200,408 (GRCm39) missense probably benign 0.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0650:Pde10a UTSW 17 9,161,797 (GRCm39) missense probably damaging 1.00
R1173:Pde10a UTSW 17 9,139,378 (GRCm39) splice site probably benign
R1386:Pde10a UTSW 17 9,172,574 (GRCm39) missense probably damaging 1.00
R1458:Pde10a UTSW 17 9,183,540 (GRCm39) missense probably damaging 0.98
R1598:Pde10a UTSW 17 9,147,976 (GRCm39) missense probably damaging 1.00
R1661:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1665:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1883:Pde10a UTSW 17 9,197,776 (GRCm39) missense possibly damaging 0.86
R1960:Pde10a UTSW 17 9,161,750 (GRCm39) missense possibly damaging 0.74
R2005:Pde10a UTSW 17 9,147,923 (GRCm39) critical splice acceptor site probably null
R2071:Pde10a UTSW 17 9,180,827 (GRCm39) missense probably benign 0.22
R2121:Pde10a UTSW 17 9,196,047 (GRCm39) missense probably damaging 1.00
R2376:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R3721:Pde10a UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R3872:Pde10a UTSW 17 8,975,923 (GRCm39) missense possibly damaging 0.92
R4627:Pde10a UTSW 17 9,200,484 (GRCm39) missense probably damaging 1.00
R4652:Pde10a UTSW 17 8,975,885 (GRCm39) missense possibly damaging 0.82
R5107:Pde10a UTSW 17 9,163,802 (GRCm39) missense probably damaging 1.00
R5184:Pde10a UTSW 17 9,195,987 (GRCm39) missense probably damaging 1.00
R5354:Pde10a UTSW 17 9,180,812 (GRCm39) missense probably damaging 0.97
R5735:Pde10a UTSW 17 9,160,024 (GRCm39) missense probably damaging 0.99
R5878:Pde10a UTSW 17 9,168,204 (GRCm39) missense possibly damaging 0.85
R5921:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R6027:Pde10a UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
R6145:Pde10a UTSW 17 9,147,949 (GRCm39) missense probably damaging 1.00
R6279:Pde10a UTSW 17 9,197,789 (GRCm39) missense probably damaging 0.99
R6409:Pde10a UTSW 17 9,168,270 (GRCm39) missense probably damaging 1.00
R6870:Pde10a UTSW 17 9,186,356 (GRCm39) missense possibly damaging 0.56
R6947:Pde10a UTSW 17 9,188,424 (GRCm39) missense probably damaging 1.00
R7072:Pde10a UTSW 17 9,161,858 (GRCm39) missense probably benign 0.40
R7084:Pde10a UTSW 17 9,159,994 (GRCm39) missense probably benign 0.25
R7294:Pde10a UTSW 17 8,975,853 (GRCm39) missense probably benign
R7339:Pde10a UTSW 17 8,975,860 (GRCm39) missense probably benign 0.01
R7347:Pde10a UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
R7373:Pde10a UTSW 17 9,161,824 (GRCm39) missense probably benign 0.00
R7481:Pde10a UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
R7833:Pde10a UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
R7923:Pde10a UTSW 17 9,147,964 (GRCm39) missense probably benign 0.40
R8053:Pde10a UTSW 17 9,193,604 (GRCm39) missense probably benign 0.12
R8722:Pde10a UTSW 17 9,163,772 (GRCm39) missense probably benign 0.01
R8918:Pde10a UTSW 17 9,160,063 (GRCm39) missense possibly damaging 0.65
R8973:Pde10a UTSW 17 9,143,071 (GRCm39) missense probably benign
R9113:Pde10a UTSW 17 9,197,782 (GRCm39) missense probably benign
R9163:Pde10a UTSW 17 9,181,791 (GRCm39) missense possibly damaging 0.89
R9275:Pde10a UTSW 17 9,200,488 (GRCm39) makesense probably null
R9563:Pde10a UTSW 17 9,020,710 (GRCm39) missense unknown
R9641:Pde10a UTSW 17 9,197,816 (GRCm39) missense
R9660:Pde10a UTSW 17 9,170,370 (GRCm39) missense probably damaging 0.99
R9670:Pde10a UTSW 17 9,020,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCGTAGCAAGTAACACACAGG -3'
(R):5'- TGTGTTGCAATGTGTGACTAACC -3'

Sequencing Primer
(F):5'- AGCCTGTGTACTCCAGGAGATAC -3'
(R):5'- GTTGCAATGTGTGACTAACCACCAC -3'
Posted On 2020-06-30