Incidental Mutation 'R8137:Tctn3'
ID632332
Institutional Source Beutler Lab
Gene Symbol Tctn3
Ensembl Gene ENSMUSG00000025008
Gene Nametectonic family member 3
Synonyms4930521E07Rik, Tect3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8137 (G1)
Quality Score99.0078
Status Validated
Chromosome19
Chromosomal Location40596446-40612233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40605341 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 462 (W462R)
Ref Sequence ENSEMBL: ENSMUSP00000025981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025981] [ENSMUST00000132452] [ENSMUST00000135795]
Predicted Effect probably damaging
Transcript: ENSMUST00000025981
AA Change: W462R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025981
Gene: ENSMUSG00000025008
AA Change: W462R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 6.3e-83 PFAM
low complexity region 578 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132452
SMART Domains Protein: ENSMUSP00000121760
Gene: ENSMUSG00000025008

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 364 3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135795
AA Change: W462R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123461
Gene: ENSMUSG00000025008
AA Change: W462R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 2.5e-82 PFAM
Meta Mutation Damage Score 0.9039 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 96.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 T G 11: 89,453,177 Q326H probably benign Het
Carf G A 1: 60,147,965 V576I probably benign Het
Ccnl1 C T 3: 65,957,870 D87N possibly damaging Het
Cgref1 T A 5: 30,934,405 D111V possibly damaging Het
Cnot4 G A 6: 35,046,287 P567S unknown Het
Cyp7b1 A T 3: 18,097,601 D149E probably benign Het
Dcc A T 18: 71,378,712 D877E probably benign Het
Dhx8 T A 11: 101,763,982 I1032N probably damaging Het
Dnah7b A G 1: 46,233,753 Y2347C probably damaging Het
Dtx3 A G 10: 127,193,172 S63P possibly damaging Het
Dyrk2 C T 10: 118,859,884 E490K probably benign Het
Fcgbp A C 7: 28,105,071 Y1868S probably damaging Het
Foxa2 T C 2: 148,043,848 H355R probably benign Het
Fpr-rs7 A G 17: 20,113,793 V145A possibly damaging Het
Gm13089 A G 4: 143,699,265 F36S probably damaging Het
Gm14137 A T 2: 119,175,356 E132V probably benign Het
Gpn2 T C 4: 133,588,562 S211P possibly damaging Het
Greb1l A T 18: 10,474,357 Q224L possibly damaging Het
Gspt1 A G 16: 11,240,668 V144A probably benign Het
Ifi204 A G 1: 173,761,622 I81T possibly damaging Het
Il27ra T A 8: 84,041,091 probably null Het
Kif21a T C 15: 90,968,442 T862A probably benign Het
Klf2 T C 8: 72,320,244 probably null Het
Kmt2e A G 5: 23,501,954 Y1505C probably damaging Het
Mcm9 T C 10: 53,622,980 T216A Het
Muc16 T C 9: 18,645,676 E3107G unknown Het
Ncor2 C T 5: 125,037,893 V169I Het
Oas3 T C 5: 120,777,500 Q42R probably benign Het
Olfr1208 T C 2: 88,896,669 *309W probably null Het
Olfr167 A G 16: 19,515,096 V180A possibly damaging Het
Pde10a A G 17: 8,974,815 Y693C possibly damaging Het
Pde11a T C 2: 76,211,039 E429G possibly damaging Het
Pygo1 A G 9: 72,944,858 H109R probably damaging Het
Rbsn A T 6: 92,190,022 V547D probably benign Het
Ros1 A G 10: 52,125,837 I1084T possibly damaging Het
Sis T C 3: 72,889,045 D1801G probably benign Het
Slco4c1 C T 1: 96,821,245 G649E probably damaging Het
Sptbn2 A T 19: 4,737,403 I914F possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Strc C T 2: 121,366,738 G1503R probably damaging Het
Sv2c T A 13: 96,088,663 Y46F probably damaging Het
Tex43 A G 18: 56,594,581 D117G probably damaging Het
Tjp3 T C 10: 81,273,691 D857G probably benign Het
Tor1aip2 C T 1: 156,063,668 T242I possibly damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Vezt T C 10: 93,939,292 N94D Het
Vmn2r105 T C 17: 20,234,704 N57D probably benign Het
Wdr59 T C 8: 111,485,379 D353G Het
Ykt6 T C 11: 5,959,368 V59A probably damaging Het
Ypel3 T G 7: 126,778,097 V54G possibly damaging Het
Zfp386 T A 12: 116,059,648 C329S possibly damaging Het
Zfp451 A T 1: 33,782,075 L232H possibly damaging Het
Zfp648 A G 1: 154,205,364 H423R probably damaging Het
Zfp729b T C 13: 67,592,742 Y468C probably damaging Het
Other mutations in Tctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Tctn3 APN 19 40597421 missense probably damaging 0.99
IGL01326:Tctn3 APN 19 40597436 missense probably damaging 1.00
IGL01351:Tctn3 APN 19 40607637 missense probably benign 0.00
IGL01604:Tctn3 APN 19 40605302 splice site probably null
IGL01844:Tctn3 APN 19 40612137 missense probably damaging 0.99
IGL02469:Tctn3 APN 19 40597523 missense probably benign 0.01
FR4449:Tctn3 UTSW 19 40607202 intron probably benign
R0333:Tctn3 UTSW 19 40607267 missense possibly damaging 0.86
R0409:Tctn3 UTSW 19 40611416 splice site probably benign
R1573:Tctn3 UTSW 19 40608917 nonsense probably null
R2288:Tctn3 UTSW 19 40605713 missense probably damaging 1.00
R3792:Tctn3 UTSW 19 40611711 missense probably benign 0.00
R3916:Tctn3 UTSW 19 40607649 missense possibly damaging 0.68
R4033:Tctn3 UTSW 19 40597323 missense probably benign 0.23
R4728:Tctn3 UTSW 19 40605742 missense probably damaging 1.00
R5093:Tctn3 UTSW 19 40612104 missense probably damaging 0.99
R5253:Tctn3 UTSW 19 40607241 missense probably benign 0.25
R5334:Tctn3 UTSW 19 40602822 missense probably benign 0.16
R5620:Tctn3 UTSW 19 40608917 nonsense probably null
R6143:Tctn3 UTSW 19 40609227 missense probably benign 0.03
R6166:Tctn3 UTSW 19 40597479 missense possibly damaging 0.92
R7629:Tctn3 UTSW 19 40611336 missense probably damaging 1.00
Z1088:Tctn3 UTSW 19 40607346 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTGTAACCAGAAATACGGACCAC -3'
(R):5'- GCTAAGGTTACTTCCTCTGGTCTG -3'

Sequencing Primer
(F):5'- CACAGATAGACTCAAGACTG -3'
(R):5'- TGTTCGAATACTAACATGGCATTGCC -3'
Posted On2020-06-30