Incidental Mutation 'R8138:Olfr1055'
Institutional Source Beutler Lab
Gene Symbol Olfr1055
Ensembl Gene ENSMUSG00000075189
Gene Nameolfactory receptor 1055
SynonymsMOR186-1, GA_x6K02T2Q125-47819205-47818258
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8138 (G1)
Quality Score225.009
Status Validated
Chromosomal Location86346624-86350284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86347586 bp
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000097479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099894
AA Change: Y60C

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: Y60C

Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188023
AA Change: Y60C

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: Y60C

Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213564
AA Change: Y60C

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Olfr1055
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1055 APN 2 86347733 missense possibly damaging 0.71
IGL02524:Olfr1055 APN 2 86347342 missense probably damaging 1.00
R0123:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0134:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0225:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R1981:Olfr1055 UTSW 2 86347142 missense possibly damaging 0.94
R4181:Olfr1055 UTSW 2 86347237 missense probably damaging 1.00
R5011:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5013:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5077:Olfr1055 UTSW 2 86347339 missense probably benign 0.00
R6312:Olfr1055 UTSW 2 86347581 missense probably damaging 1.00
R6345:Olfr1055 UTSW 2 86347548 missense probably damaging 1.00
R6591:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R6626:Olfr1055 UTSW 2 86347020 missense possibly damaging 0.81
R6680:Olfr1055 UTSW 2 86347245 missense probably damaging 1.00
R6691:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R7447:Olfr1055 UTSW 2 86346806 missense possibly damaging 0.86
R7622:Olfr1055 UTSW 2 86347662 missense possibly damaging 0.61
R8114:Olfr1055 UTSW 2 86347186 missense probably benign 0.00
R8242:Olfr1055 UTSW 2 86347082 missense probably damaging 0.99
R8260:Olfr1055 UTSW 2 86346932 missense possibly damaging 0.65
R8360:Olfr1055 UTSW 2 86347324 missense possibly damaging 0.79
R8433:Olfr1055 UTSW 2 86346800 missense unknown
Z1176:Olfr1055 UTSW 2 86346883 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
Posted On2020-06-30