Incidental Mutation 'R0042:Olfr1097'
ID63235
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0042 (G1)
Quality Score124
Status Validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86890491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect probably damaging
Transcript: ENSMUST00000111576
AA Change: I228T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: I228T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217403
AA Change: I228T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2229 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0605:Olfr1097 UTSW 2 86890419 missense possibly damaging 0.65
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R2412:Olfr1097 UTSW 2 86890834 missense probably benign 0.01
R4465:Olfr1097 UTSW 2 86891150 missense probably benign
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R5847:Olfr1097 UTSW 2 86890332 missense probably damaging 0.99
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7256:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCTGTCAGTTTTGTGCCAAGAGAG -3'
(R):5'- CGTCAATGGCCTATGACCGCTATG -3'

Sequencing Primer
(F):5'- TTTTGTGCCAAGAGAGAAGCTG -3'
(R):5'- CTGGATTTCTGCAACTCCAAAG -3'
Posted On2013-07-30