Incidental Mutation 'R8138:C1qtnf2'
ID632365
Institutional Source Beutler Lab
Gene Symbol C1qtnf2
Ensembl Gene ENSMUSG00000046491
Gene NameC1q and tumor necrosis factor related protein 2
Synonyms1810033K05Rik, CTRP2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8138 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location43474276-43491525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43486011 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 70 (G70D)
Ref Sequence ENSEMBL: ENSMUSP00000051652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057679] [ENSMUST00000151912] [ENSMUST00000173002]
Predicted Effect probably damaging
Transcript: ENSMUST00000057679
AA Change: G70D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051652
Gene: ENSMUSG00000046491
AA Change: G70D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 104 1.2e-10 PFAM
Pfam:Collagen 90 151 2.1e-11 PFAM
C1Q 152 287 3.96e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151912
AA Change: G70D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133616
Gene: ENSMUSG00000046491
AA Change: G70D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 103 6.8e-11 PFAM
Pfam:Collagen 79 137 3.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173002
AA Change: G100D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134705
Gene: ENSMUSG00000046491
AA Change: G100D

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:Collagen 76 135 7.4e-11 PFAM
Pfam:Collagen 121 181 1.9e-11 PFAM
C1Q 182 317 3.96e-46 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 probably benign Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in C1qtnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00266:C1qtnf2 APN 11 43485999 missense possibly damaging 0.93
IGL03178:C1qtnf2 APN 11 43490989 missense probably damaging 0.98
PIT4305001:C1qtnf2 UTSW 11 43491195 missense probably damaging 1.00
R0226:C1qtnf2 UTSW 11 43490843 missense probably benign
R1412:C1qtnf2 UTSW 11 43491132 missense probably damaging 1.00
R1796:C1qtnf2 UTSW 11 43491287 missense probably damaging 1.00
R2145:C1qtnf2 UTSW 11 43490984 missense probably damaging 1.00
R2504:C1qtnf2 UTSW 11 43491156 missense probably damaging 1.00
R3829:C1qtnf2 UTSW 11 43491321 missense probably benign
R5106:C1qtnf2 UTSW 11 43486053 missense possibly damaging 0.71
R5547:C1qtnf2 UTSW 11 43490967 missense probably damaging 1.00
R5879:C1qtnf2 UTSW 11 43486008 missense probably damaging 0.99
R8218:C1qtnf2 UTSW 11 43490948 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GACAACCATGATCTCCTGGGTAC -3'
(R):5'- TCAGCAGATGGATGGTCTTC -3'

Sequencing Primer
(F):5'- AACCATGATCTCCTGGGTACTCTTG -3'
(R):5'- TCCAATTGGTTATTAACAGGTAGTG -3'
Posted On2020-06-30