Incidental Mutation 'R8138:Nin'
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Nameninein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8138 (G1)
Quality Score225.009
Status Validated
Chromosomal Location70011435-70113717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70042898 bp
Amino Acid Change Serine to Proline at position 1248 (S1248P)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
Predicted Effect probably benign
Transcript: ENSMUST00000021468
AA Change: S1248P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: S1248P

internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: S1248P

internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095666
AA Change: S1248P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: S1248P

internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169074
AA Change: S1248P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: S1248P

internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably benign
Transcript: ENSMUST00000223257
AA Change: S1248P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8141:Nin UTSW 12 70030021 missense
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer

Sequencing Primer
Posted On2020-06-30