Incidental Mutation 'R8138:Habp4'
ID632371
Institutional Source Beutler Lab
Gene Symbol Habp4
Ensembl Gene ENSMUSG00000021476
Gene Namehyaluronic acid binding protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R8138 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64161824-64186537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64176070 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000021929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021929] [ENSMUST00000221904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021929
AA Change: D269G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021929
Gene: ENSMUSG00000021476
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:IHABP4_N 16 163 2.3e-52 PFAM
low complexity region 174 201 N/A INTRINSIC
HABP4_PAI-RBP1 212 316 5.03e-34 SMART
low complexity region 365 383 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221904
AA Change: D269G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 probably benign Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Habp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Habp4 APN 13 64174071 missense probably damaging 1.00
IGL02367:Habp4 APN 13 64174091 missense probably damaging 1.00
R1976:Habp4 UTSW 13 64184606 missense probably benign 0.09
R2012:Habp4 UTSW 13 64170181 splice site probably null
R2884:Habp4 UTSW 13 64182266 missense probably benign 0.40
R3800:Habp4 UTSW 13 64174103 missense probably damaging 1.00
R6404:Habp4 UTSW 13 64182186 missense possibly damaging 0.55
R7029:Habp4 UTSW 13 64162125 missense probably benign 0.08
R7985:Habp4 UTSW 13 64176046 missense probably benign 0.05
R8025:Habp4 UTSW 13 64174831 missense probably benign 0.08
R8046:Habp4 UTSW 13 64174842 missense probably benign 0.11
R8314:Habp4 UTSW 13 64184751 missense probably damaging 1.00
RF038:Habp4 UTSW 13 64162162 small deletion probably benign
Z1177:Habp4 UTSW 13 64174068 missense probably benign 0.00
Z1177:Habp4 UTSW 13 64174070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATTTGGATTCTCTGCCTC -3'
(R):5'- ATCTGGTATCCTGCTCTGGC -3'

Sequencing Primer
(F):5'- AACATATTTTTAGGCATCCCTGACTC -3'
(R):5'- TGGCCTCCACATTCACAC -3'
Posted On2020-06-30