Incidental Mutation 'R8138:Mblac2'
Institutional Source Beutler Lab
Gene Symbol Mblac2
Ensembl Gene ENSMUSG00000051098
Gene Namemetallo-beta-lactamase domain containing 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8138 (G1)
Quality Score225.009
Status Validated
Chromosomal Location81711341-81753275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81711650 bp
Amino Acid Change Aspartic acid to Glycine at position 41 (D41G)
Ref Sequence ENSEMBL: ENSMUSP00000051644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048993] [ENSMUST00000057598] [ENSMUST00000161920]
Predicted Effect probably benign
Transcript: ENSMUST00000048993
SMART Domains Protein: ENSMUSP00000035289
Gene: ENSMUSG00000035834

Pfam:RNA_pol_3_Rpc31 1 223 7e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057598
AA Change: D41G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051644
Gene: ENSMUSG00000051098
AA Change: D41G

Lactamase_B 29 231 4.92e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161920
SMART Domains Protein: ENSMUSP00000125054
Gene: ENSMUSG00000035834

Pfam:RNA_pol_3_Rpc31 1 105 1e-13 PFAM
transmembrane domain 136 158 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Mblac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mblac2 APN 13 81750006 missense probably damaging 1.00
IGL01377:Mblac2 APN 13 81750147 missense probably damaging 1.00
IGL01767:Mblac2 APN 13 81750315 missense probably damaging 1.00
R1299:Mblac2 UTSW 13 81711726 nonsense probably null
R2006:Mblac2 UTSW 13 81711741 missense probably benign
R2435:Mblac2 UTSW 13 81750249 missense probably damaging 0.99
R4031:Mblac2 UTSW 13 81750089 missense possibly damaging 0.59
R4804:Mblac2 UTSW 13 81750309 nonsense probably null
R4865:Mblac2 UTSW 13 81711976 nonsense probably null
R4906:Mblac2 UTSW 13 81711587 missense probably null
R5480:Mblac2 UTSW 13 81750276 missense possibly damaging 0.77
R7760:Mblac2 UTSW 13 81711877 missense probably benign 0.00
Z1177:Mblac2 UTSW 13 81750167 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2020-06-30